Open Close
General Information
FlyBase ID
Feature type
Component Allele(s)
Expression Data
Associated insertion(s)
Molecular map
Description and Uses
Location-dependent role
CV term
Qualifiers and info
Construct components

Constitutively expresses two sgRNAs (TTTCATACTCAACCTCGCCA and AACAAGCTCCTTTAGACCCG), each of which targets non-coding sequence within the PBac{nSyb-tdGFP} construct.

Sequence Data
Sequence (FB)
Associated Sequence Data
DNA Sequence
Segments and Size
Total Size
Left end
Right end
CV term
Qualifiers and info
Component Alleles
Expression Data
Reporter Expression
Additional Information
Marker for
Reflects expression of
Reporter construct used in assay
Progenitors and Descendants
Stocks (0)
External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
Secondary FlyBase IDs
    References (2)