Open Close
General Information
Symbol
PBac{U6-gRNA.0-4}
FlyBase ID
FBtp0134105
Feature type
transgenic_transposon
Component Allele(s)
Size
Expression Data
Associated insertion(s)
Molecular map
Description and Uses
Location-dependent role
Description
CV term
Qualifiers and info
Reference
transposon
Construct components
Description

Constitutively expresses two sgRNAs (GCTTCCCGAAGGGAGAAAGG and AACAAGCTCCTTTAGACCCG), each of which targets non-coding sequence within the PBac{nSyb-tdGFP} construct.

Sequence Data
Sequence (FB)
Associated Sequence Data
DNA Sequence
Extent
Segments and Size
Total Size
Left end
Right end
 
Segments
Num
Orientation
Symbol
Reference
Features
CV term
Qualifiers and info
Reference
Component Alleles
Expression Data
Reporter Expression
Additional Information
Statement
Reference
 
Marker for
Reflects expression of
Reporter construct used in assay
Progenitors and Descendants
progenitor(s)
descendant(s)
Comments
Stocks (0)
External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
PBac{U6-gRNA.0-4}
gRNA-(0-4)
Secondary FlyBase IDs
    References (2)