Open Close
General Information
Symbol
Dmel\fs(1)N-RA
Species
D. melanogaster
Annotation Symbol
CG11411-RA
FlyBase ID
FBtr0070207
Feature type
Associated gene
Evidence Rank
Length (nt)
6581
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 29 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AGTTTTTTCTTCGCATATCTGCCTCACGTGTTTGGTTTTTTGTCAATTAACTGTGTGCAAAATGCTAATTTGGCACCTGC
      TGCTCTGGCCAGCATTAATAGCCAGTGCCCCACCGCGGCCCCTGACCGACCAAAAGGCCGAGGTGGCCAAGCTGCGAAGC
      GAACTAGAAAAAGCTCTGGAACACGACGATGGAGGAGCACCACCAGGAGTGGTGGTGGCACCCACGTGGACCCAGCAGGC
      GGGGCAAATGCCGCTTGGAAAGACCTCCAAAGTGGTGGTGGACCATAGCTCGCTGAGCAGCGCCTCCGCCATTCGCCAGG
      AGATTCAGCAGGCGGTGGCTCACCAGGGACAGAACCAAGAGGTCCTCCAGCTGGAAGCTCTGCTGAAAGCAAGAGGCAGC
      AGCAAGGAGAGCACGGCTCAAGTGTCCACGTCCCGTCAGGAGGTGCTGGGAGCAACTGTACAGGAAGCCAATGTGGTGGA
      GTCGCACTCGACATCGCAGACCGTGGACCTGGAACAACTACAGCGCCTGGAGCTGTCCAAGAGGCGCACCCGCGACATGC
      TCGTCCTGGGTCGCATTGAAGAGTTGCTCAACTACAGCATGCCGACGGATGTGGATCGCTGGCTGACCCTCCAGGCCAAT
      GGAAGCGTTTTCCTTGTGGGTCAGCAGCAGGAGGGCCTCCTGGTTCTTTCAGAGGAATTCACTCCGTTGCAGTCTTATGT
      CCACCCCTTTCCCATCACCGCCATGCTGGGAACAGATCGCTGGAACAGAAGGGTGCATATGCAGGAAGGTTTGCTGGTGA
      TGGCTTCCCAGGATCAGCTTATCTGGCTGCGATTGGAGCCCAGTCTTGGGCTAAAACCCATCTGGCACTGGACGATTGGC
      TCGCATGTGACCAAGATTAGAGCATTCAACATGGAGGGACAAGATTACCTCGCTCTCGTAGCAAATCACACGCTTAATAT
      CTACGTCTATGATTTGGAAGCGGAGGAGTTCTGGATCGCACAACGTGTGCAAATGGCAGAGACGATCTCCAACCTGGCCA
      TTCTCGATACAGGGAGGGAACTGCTCTTGGCAGTGGGTCAGTGGGACGAGGTTCTGATATACGCCTGCACTTCGAAGGGG
      CAACCGCTGCACTTGCGCCAACAAGTTGCTGCCCCCGAGGTGGCCGGCGTCACTGCCTTCCAAATGGGCGGACGCAGCTA
      CCTTGCGCTGGGTGGAATAATGCCGCAGATCCTGGTCTACGTGCAGGGTCAGCTTGTGCCACGCACCATTCTTGGCCAGA
      ACTTTGGATTTGTAGACCACTACCTTCCAATCCCCGTGCGCAGCTACAGAGACGACCTACTTCTGCTCGTCCAGCATCGA
      GTTGTCTTTGACACACATTCACTGCTCGTCCTGGAGGTTTTGGTTTGGAACGGTGAGGCGTTTGAGGCGGGCTTGCCGCC
      TCCTTGTGGTACTGCCTATGGGGCGGGCTGCATGTTGGATCAGGATCGTGAGGCTGGCATTTCAGGAGCTGTCCTGCTCC
      GCCGCTCGACGAATCAGCCGCCGCTGGTTGTGGTGCCCAGGAAAGAAGCTCCTACGGGCATTTTTGTGCTGGAAACTCAA
      TTGCTGGCTAGGAATTCGGAGACACAGGACCTGCTGGAGATCCGACAGTTCATGCAGGATTGGGTGCACGAACAGGAAGA
      GCTAATCCAGCTGGCTGAAGAGCTCTTGGCAGAGAAGTCGGAGAGTCAGTACATCGAGGAGCTATCAACTCCACTGGTTG
      TAAGCGAGGGCGGAACCGTTGAGGAACTTTTCGTTAATGAAGCTCGCTGGACGGGAGCGGATGCTGTTGTGGATGTAAGC
      TCCCTGCTTCAGCAGATACTTCTGTTGGACGGGGAAATGAGTTCTAGGCGATCTAAACGCCAGCCAGAGACGCTGTTCAA
      CTTTCACTACGAGCAACTGGAAGTAGAAGCCGTTGACTCTGTGGAACTTAACTTGGAGAAGCTCAACCATGAGACGTTCT
      ATATCCGAAATGGCTCCCTTGACTTGCATCTGGGAACCCTCAATGTTCAGCAATTGGAACTTCTGGAAGCTCCGAAATTG
      GAGCTCGTCCCAGTCCACGGTGCAGAATCATACAAAATTCTGAAGATGGCTACGGATTTGGACAGCATTTTTATTAACGA
      AATGGAGTGGGACAAGCTGCTTCAAGATCTGGTGTGGCGTCATCAGCCTCTTAAGCTTTCGCAGTTACATGTAGAGGGAC
      CGGTCATTTTCGAAGATGTACTAAGTTTGCACTCTCTGAACGACCTAAGCTTTCCAGGAGACTATCTCTGGTCGCAGGGA
      AATGAGACGAGTGTTGTCCAGGCGCCAAAGGAGTTTACGCAAACGCTTTCTGCAAATGCTGTGGACACGACGGGAACCAT
      CAACGCCGTATACCCGCATGATGTCATTACTCTCAGTGATTCCCAGGAATGGCCGGGATTGGTAACCTTCTCGCATTTGG
      AGGTTTCTGAAGAATTGGAGCTCAATGGCAGCGCCCAGGGAAGGCAGTTTGAGGAGGCACCTTTAAATCCCACTCTGCTG
      GAGTCACGTGTTATCAGTGCCGACTGCCATTTCGAACAGCTTCTTGTGCGTGGCCCTTTGCGGCTGCTTGGAAAGGTGGA
      TAACGACAGCTTTGGCTCTCTGCTAGGAGATCTCGTTCAGCGTTCGCCGAACTCTGCCCAAGAACTACAGATAAGTGGAC
      AAAAGCGAGTTGACCAGCTGCTTCTGCCAGTGGATGCTCATATCGCAGATAATCAGCTCAGTGGAATTTTCCTCAATGAC
      TTTGTTACCAAGCACACGCCACAAACGCTGTCGAATCTGAGTCAACTGGGAGGGTATGTTTACTTTCATCAGCTGGAGCT
      TGGGAAAGAGTCCTCTTACGACGGAGTTCGCCTAGAGGAACTACTCTCCAAAAGTCTTCGACTAGATAGCCCATTTCCCC
      TGAGTTCTCCCCACACACGCCTTCGGTTTGTTGGACATGCCCCAAATTTCACCCGGCTACAAGTTGAAAACACCTTGAAC
      AAGGTGCCGCTGTCAAGTGGCTACCAGCTGCTCCATGAACCGCTCCATCTAGGCAGAGCTAACTTTAGTCGTCTGATGGC
      AGGGCAAGCGCAGGTTAACTATGATGTCTCTGGCAACGGGCTACTCAATGGACGAAGCCTGATCCGTATTCTACAGGAGC
      AACCTAGGACTTGGTCGGGTGAAGTGCACGTGCAAGAGCTTATTCTTCCCCAGGGTGTGCAGGCGAACCAGCTGCAGGGC
      ATTAAGGCAGACCTTCTGCTGGATTTTCTGCAGCAGCTGGACGAGCTCCCGTTGCTGATCCTTCAGGGTCGCATCCAAGT
      TGAACGCATCGCCGTCAACGGTTCGGTGCAAGCAGCTGAAACCTTGAACATGCAACCCTTCCACGAACTTCAGAGGCAAG
      TCGTTTGGCTGGATAGGCAGAACGAATTAGGGACGCGTTGGGTTCTGAAAGAATCTCCCCAGTTCCAGCAGAACCTCCAA
      GTTCTGGGCAGCTTTAACGAGCGCCTGCTCCCAGAATTGCTGGATGACATTGTGCTGCGCTCCGACGCGCACGAGGTGCT
      GATCGAGGGCACCAAAAGCTTCTTGGCTCCTGTTAACACTAAAGAGCTTCATCTGGCTGCACTGAATGGGATTCCCTTCA
      ATCACATGGCCAACAAATTATCTCCGCTGCACCTCACTGGAAATGTCCGCATTCAGGGACGCATCTTTGTGGAGGACCTG
      CAGCTAAATGGTCAAGTAAACGGAGATCCGGACATTCCTGCTGATCTGCAGAAACTGCTCCGCTGGGATCCAAATGCAGG
      TGGCTTTGTGCACCGGGGAGTCGTTGAACTTCCAAAAAAGGAGCTAGAACGCCTAGTGGTTTTGGGCCACTTGAAAAATC
      GCAGCCGTGAGCCCGTTCAGGAACTCTTTGATCAGCTAGTCTTCAAGCAGCAGCGTGGCATACACTTGCATGGTCACAAG
      ACTTTCACAGGCCGTCTTCGCATTGAAGATGGAGCTCACATCAAGTTCTTCAATGGACGCAACCTAGAACAGTTCCTAGA
      GAATTTAATCTACGTGGATTCGCAGGGAGAGATACGTTTGGAAACACCTGTTCGCTTTGCGGCTGATGTTAAAATGGATC
      ATCTTGAAGCAGATCGCCTTGTACTGTCGGGAGAGCTGCTTAACGGATGCAATGTGAGCCAGTGGCTCCGGGACACTATT
      CGTGTCGATCGCGATTTCCAACAGCCTGAGATTGCGTTTGCAAAGGGATCGCTGGATGGTAATTTCTTGGAGGTTGAGGA
      GCTTAACGAAGTTAATCTCTCACTGGTTGTCACCCGCTTCACGGAGCAACAGCTAAGCGATCCCCTAGAGGCAGATGATT
      TGCTCCTAGATGGCCAGCTGGTGGTAAGGGGCACTGTTAATGGTTACAATCTACCAGAGGAGTATGCCAACACTTTAATG
      ATTAACCCATTGCGAGAGCAGCAAGTGGATACGCCTTTATTGTTGTCTAACATTTTTGTCACCGGACCCCTGGAGGTAAC
      TGCTCCAGTTCATGGTCTAAACATAAGCGATGTGGCAATTTTGGGCGAAGATCCAGTGCTGCTGCAATCGCCGCTATATT
      TCGACACTCTGCATGCTCCGTTTTTGAGAGCGCAACAGAACATCAATGGATTTGACTTTAGGGCTTGGTACGGAGGAAGC
      TTATGGGCAAGAGGTCGGGAGCAGCAGGAAATAAGCGGGAACTGGCGCGTAAAGAAACTGCAGGTGAAGCAGGGTGATGA
      GCTGCGACCACGTCGACAAACTGCAGAAGAGAGCTACCGGGAGTTCTGCGAGGGTTTGGTCAGGATTCTCCTGCCTTACA
      AGGTCCAGAAGCTGCGGCGGAGATTTGATTTAAATCAGGAAAGGGATCAGGAGAATATTCGCCGAGTATTTGCTTTGGAG
      GCACCCGGGGGCATTAGTTATCTTCTGATCAACGAGCGAGGTTGCTGGACCCGCATCCACCGCTGGAATGGATCTTTATT
      CGATCGATCCGGAGCCTTCAAGAGCGGACCTGTGGACGAGGCAGTTGCTTTACGGGTGGGAAACACAAGCTCTAACCAGG
      ACTTTGCCTTTATGACCAGCTACGAGTTGCAGGATGATCAGAACGAGCCAAGCTTGAATTGCAGTGCAGTGAAGCCCATT
      CTGCTGAGCTGGAACCTGAACAAAACAAAGAGCACTACTGAGCACATGGAACTATCAGCGGACACCCTAAGAAATCTCAA
      AGATCAATATGAGCAGCTTAAAAACCAGCCACTCCCTAATCCCAGTTACCAGCAAGCTTTTAAGTATCTGCAGCGTCCCA
      GCATCAAGTCTCAGCTCGGATCACAGTGGCAAGAGAATAAACATGAACTGAGTCCTTCGGAGATGGCCAGAATGCGGAGA
      CGTCTGCTGGACACCTTGGAATTCCGGTTGCAAGCGGAGGTAAACATTACCCAGTTAAGTATTCCAGAAAGCGACCTATT
      CGACGAGCACCTTGTGGAGGATTTTCTGGAGTTGATGCGCCAATTGCGAACCTTGCGCCGGCGTCTAGATACAGAGACTC
      TTCCACTGCCAAACACGCCGGCAAGAGTTCTGGCCGCACGGAGTGCCCAGCTCATCTGGCCCACGTTGCAGGAGTTGCGA
      GAGGTTTCGAGTGGAAACGATTCTAGCTTCCAGGAGCAAGTTCTGGAGCAAACGCTGCTGGATGTGCTGATGCTGGCTAA
      TGAAGAAAATGGCTCGGGGGATGATGAAAAGCTGCATGCGGTGATTCAGAGATTGAGAAACCTTAAAGGAGAGCTTCAAG
      GGCAAGAGGAAGACGACGAGGGACCTGCTGCCTCCTATTCGGACAGAAATGAGCAGCGTTTGCCGCTACCAGAAGTCGAC
      TGGAGACCCATTCAAACACTTCGCCTCGCTGTGGGACCAGCAAACCGTCCCCGACTTCTTTACGCCCGGCTGACCGTGGT
      GACACCAACAGACGGTCCTCCGCCCACCACGCCCTCCACTGCGCCAGCCGCCCACATCCAACTGCATCATGCAAATGGAT
      CGCTCTTTCAAACGCTAGCAGGGGAGCATGGAGCACGCCATCTGACATCGTTGCGGGTACGAGATGAGACGCTGCTAGCA
      TTTATGGAGGGATGCTGCCGTATAAGAGTGCTTATCTACCGCGGTGTGCAGGGATTCGTGGACTTTGTCCGTTTCCCCGC
      ACCTGCCCAAGAAGCTAAGAGCGGAGATGGGGAGGTCTTGCAGTTACTATCCCTACGCTTACCTCTCAATCGGCCACCCG
      GAGCCATGTACTTATTGGCAGTGGTTCAAGCTCGACGCGTCACTTTCTACGAAGTGGTGGTAGCCGGATTACTAGAGCCG
      TGGCTCCAGTGCCCATGATTGTTAAATTAAAATGTATATGTAAACTTGTTTAGATGGATGATAGTGAGTTGCTTATAAGA
      TGTAGTTAGTTATCTTTAGTGTGCTGTTTGTTAACTGTGTAATATTATTGTAATTATTCTTCTTGTTGTGAATAAACATT
      GGTTTGGTGATGTTTAAAAAG
      
      Other Products of this Gene
      Other Transcripts
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0070200
      2118
      Derived from OTHER transcripts
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG11411-RA
      fs(1)N-RA
      Secondary FlyBase IDs
        References (2)