Open Close
General Information
Symbol
Dmel\csw-RA
Species
D. melanogaster
Annotation Symbol
CG3954-RA
FlyBase ID
FBtr0070378
Feature type
Associated gene
Evidence Rank
Length (nt)
4560
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 90 )
Sequence
TTCTTAAATCGACTGGCCACACCGCACAGCCCAGTAAAAAAATAGTTTTTTTTTTGTATCCAACCAACCAACTGTAAAAA
TAAGTTTAAACAAAGCATCTACTCATAAGTTTCATTTTTTTCCGTTAAGTGTCAACATTATTTATTTTTTAAGTGTGCAT
TCAATAAGAAAATGTCATCGCGAAGATGGTTCCACCCAACGATATCTGGCATCGAAGCTGAGAAACTGCTGCAGGAGCAG
GGATTCGACGGCTCCTTCCTCGCCCGCCTCTCCTCCTCGAATCCGGGCGCCTTCACGCTCTCCGTGCGCCGCGGCAACGA
GGTGACCCACATCAAAATCCAAAACAATGGCGACTTCTTTGATCTCTACGGTGGTGAAAAGTTCGCCACACTGCCGGAAC
TGGTACAATACTACATGGAGAATGGCGAGCTAAAGGAGAAGAACGGCCAGGCCATCGAACTCAAGCAGCCGCTGATCTGC
GCCGAGCCCACCACGGAAAGATGGTTTCATGGCAATCTTTCCGGAAAGGAAGCGGAAAAATTGATCCTGGAGCGGGGCAA
GAATGGTTCGTTTCTCGTCCGTGAATCTCAGAGCAAGCCTGGCGACTTCGTCCTTTCCGTGCGCACGGACGACAAAGTAA
CGCATGTCATGATTCGATGGCAGGACAAGAAGTACGACGTCGGCGGCGGGGAATCCTTTGGCACCTTGTCGGAACTGATC
GATCACTACAAGCGTAATCCCATGGTGGAGACGTGCGGAACCGTGGTGCATCTGCGACAGCCATTCAACGCCACACGAAT
CACGGCGGCCGGCATCAATGCCCGGGTGGAACAGCTGGTCAAGGGAGGTTTCTGGGAGGAATTCGAATCGCTGCAACAGG
ACAGTCGGGACACATTCTCGCGCAACGAGGGCTACAAACAGGAGAACCGCCTCAAGAATCGCTACCGCAACATATTGCCA
TACGACCACACGCGCGTCAAGCTGCTGGACGTGGAGCATAGCGTGGCCGGAGCCGAGTACATCAATGCCAACTACATACG
GCTGCCCACCGACGGCGACCTGTACAACATGAGCAGCTCGTCGGAGAGCCTGAACAGCTCGGTGCCCTCGTGCCCCGCCT
GCACGGCTGCCCAGACACAGCGGAACTGCTCCAACTGCCAGCTGCAAAACAAGACGTGCGTGCAGTGCGCCGTGAAGAGC
GCCATTCTGCCGTATAGCAACTGTGCCACCTGCAGCCGCAAGTCAGACTCCCTGAGCAAGCACAAGCGGAGCGAATCCTC
GGCCTCTTCATCGCCCTCCTCCGGCTCTGGGTCCGGACCAGGATCGTCGGGCACCAGCGGAGTGAGCAGCGTCAATGGAC
CCGGCACACCCACCAATCTCACGAGCGGCACAGCCGGATGTCTGGTCGGCCTGCTGAAGAGACACTCGAACGACTCGTCC
GGAGCTGTTTCTATATCGATGGCCGAACGGGAACGCGAGAGGGAGCGCGAGATGTTTAAGACCTACATCGCCACCCAGGG
CTGTCTGCTCACCCAGCAAGTGAACACGGTGACGGACTTCTGGAACATGGTCTGGCAGGAGAACACGCGGGTGATCGTCA
TGACCACCAAGGAGTACGAGCGCGGCAAAGAAAAGTGCGCCCGCTACTGGCCGGACGAGGGTAGATCGGAGCAGTTCGGC
CACGCGCGGATACAGTGCGTCTCGGAGAACTCGACCAGTGACTATACGCTGCGCGAGTTCCTCGTCTCGTGGCGGGATCA
GCCGGCGCGCCGGATCTTTCACTACCATTTCCAGGTGTGGCCGGATCACGGAGTGCCCGCCGATCCGGGCTGTGTGCTCA
ACTTCCTGCAAGATGTCAACACGCGTCAGAGTCACCTGGCTCAAGCGGGCGAGAAGCCGGGTCCGATCTGCGTGCACTGC
TCTGCGGGCATCGGTCGCACTGGCACCTTTATTGTGATCGATATGATTCTCGATCAGATTGTGCGCAATGGATTGGATAC
TGAAATCGACATCCAGCGCACCATTCAGATGGTCCGATCGCAGCGTTCCGGTCTTGTGCAAACCGAGGCGCAATACAAGT
TCGTCTACTATGCGGTGCAGCACTATATACAGACCCTGATCGCCCGGAAACGAGCTGAGGAGCAGAGCCTGCAGGTTGGC
CGCGAGTACACCAATATAAAGTACACGGGCGAAATTGGAAACGATTCACAAAGATCTCCATTACCACCAGCAATTTCTAG
CATAAGTTTAGTTCCGAGTAAGACGCCACTGACGCCGACATCGGCGGATTTGGGCACTGGGATGGGCCTAAGCATGGGCG
TGGGCATGGGCGTCGGCAACAAGCACGCATCGAAGCAGCAGCCGCCGTTGCCGGTGGTCAACTGCAACAATAATAACAAC
GGCATTGGCAATAGCGGCTGCAGCAACGGCGGCGGGAGCAGCACCACCAGCAGCAGCAACGGCAGCAGCAACGGTAACAT
CAACGCCCTACTGGGCGGCATCGGCTTGGGGCTGGGCGGCAATATGCGCAAGTCGAACTTTTACAGCGACTCGCTGAAGC
AGCAACAGCAGCGCGAGGAGCAGGCTCCGGCGGGAGCAGCAAAATTCAAAAACATTCCCAAAGACATGATCGGCTTGCGA
CCGCCAAGCCATGCGCCTGCGTTGCCGCCGCCACCGACACCGCCGCGCAAAACATGACAAATGAATTTCTAAGTCGCGAC
GCCCCCTTGACACGCCCCCTTGACACGCCCCCCTGACACCCACCTCCCTCCACACGCACACAGACCACATATGGTTTTCA
TTTTAAATGTCACCCAGCCGCCGCCCCAAACCCAAAACCCAATCCCTCGACTATGTTTTACTGTTGTACCACGTTCTACG
TTTTTTTTTTTTTTTTATAATTGTAATCTATATACTTTTTTGTAATTGTGTGTAATGTAATGTTTAGTTTTATGTTATTG
TCTCGCTTTATGTTGTAAGTGTTCCCTGCACACGAAAAGCAGTAACCCCACCACCACCCCAAAACCCAAAACCCAGCATA
TTTATGTAGTAGTATTGTAAGAATCCCCGAACCGGTAGTTGAGGATACAATCTGGGCGGAACTGCAGCAGATCCGCCAAA
AAACAAAAACACATTTTTAAGCAGAATCGCAGCAACAAAATATAACACCCGTTCCCTGTTCCAAACCGCTTGAATTTGGT
GGAATCGGCCTTGATAGTATTTCACTTTCTTGAAAATATTCGCTTTAGATAAGAAAATTGACTTGTGACAAATATTTACA
TGTATTGCGCTGGTTACAAACCACAAAAGTTGCTTAACTTTAAATTTTACGAATCGACATTTATGATATTTCGCATGCTT
GAAAATAGTTGTAGTTTCCTATTTGGGAATCATTGAAAAATCCATTTATAAAGCGAAATCCAGTTCTGGCACGTTCAATT
TGAATCGGTTAATTTCTAATCTAGTTGGCGAAAAAGTGAAGAAAAGTGAAGTCCACCTCCTCCAAATTCAACTTGAAACG
GAAACGGGTTACCGGTTGGAGTGCAAATAAAGTTTTTAGTGTAGTAAGTGTTGACAAAATCGATAGAGAAGAAATTAGAG
GAGTAACTGAGGCAGTAAGCACGTAACGATAATGATACAAAAAGCGTTGATTGTGATTCGAGTGACAGCGAGAACAGAAA
CTGAAACAGTAACAGTAACAGTAACAGATGAGAACAGATGCGAATGGGATCAGTACAGAACAGAACAGAACAGCGGAGAC
GCCAACCGAACAGAACAGAAATGAACAGAAGAGAAGAGAACAGATTAGAGGTAAAAGAAAAAGCTAAGAAGCGCTTAAGC
GTGTCGTCCCTAGAATAAGAAAACTAATATTACAGCTCCACAGATCCAGATTCAGATCCAGATCTATATCTCTAGCAGCC
AATTTCTGATTTCCCCTTCCCTCTTAGTTTTCCCATTAATTTAGTGATTGTGTGTATATTTTTAATTGTATATTGAAGAT
TATTTATAGCGATTGTCCATTGTGTTACATTTCAAATGTTCGAAAGAATTGTATTTAGAAAGTTTGTACTTTAGAAATTA
TGCATTAATTGTGTGTCTGTGTCTCTCTACCCAGTCTCCCTATCTCTGTCTCTCTCTCTCTCTCTCCCTCACTGTCTATG
CACGAGTGTTTTCTTAACTAAGTTTATTATTTCAACGCTGAAGCGTAATCAAACTATATATGCAATATTTAAGCACAGTA
CCTTGGGCGCTGCAAAGAAATTAAAAAATTTTAAAATAAAAACAAACTGCTAAATCATAAATACAAAATATATACAGGAA
GGAATAATAGCAGCGAAATGTAAATCAATTAGATTATTGTGCAAATTTGAGTAATATATTTAAAACATACCCTTATTTTA
TCTTATTTAACTTTATGCTTTTGTAAGTGCTTTAAATTGTTATTCATCTTGATCTTGCAAAAAAATGAAAAAACCACAAA
ACTGAAAAACGAATACAAAACTAAAAAACAACACAAATTATATTTGTATTTATACAGAAAAATAAAACATTTTATATGCG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0070379
7664
FBtr0070380
4106
FBtr0333260
7119
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0070362
841
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0070363
945
FBpp0070364
682
FBpp0305458
894
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG3954-RA
Secondary FlyBase IDs
  • FBtr0005595
References (2)