Open Close
General Information
Symbol
Dmel\csw-RB
Species
D. melanogaster
Annotation Symbol
CG3954-RB
FlyBase ID
FBtr0070379
Feature type
Associated gene
Evidence Rank
Length (nt)
7664
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 62 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ATTCATTCATACCCCAGCGCTTAGAACACCACCAGGCCACAGCTCCCGTCCGAGAGATATAGCCACTAAGAGAGAGCGGA
        AGAATCGAATCGCAAAGAGAGGAGCCGCGCTGAGACAACGTCAAGAATCCGATTTCGATTCCGATTGCGATTTCGAATCC
        GAGGCAAAAAGCTTCAGACTCGGCAGCAGGCGCTTCATTCTCGAGTTGTGATCCAACGGGTTAGCAGCTCAGCTCGCAAG
        CAGTCGCCGTTCGTCGTCGAGCGGCAAGCAGTTCGTTTCATTTCTACTGGGCGCCAGTACAAGTTCCATCGAGTGTTTTT
        GTTATTCGAAGGCAAAGCGCGAAAATTATGCCTTCAGCCACATTTGTCCTGGAGCATTTGATGGCGGCACAATCGCGACT
        CGACGAGCAGGCCGCATCCCCAGCAGAGGTCAAACCCACCAGCACCATCAACAGCAGCAGCACCACCGTGGCCAAGGCCA
        TCAATGTCAAGTCGTACGAAAAGAAGCTGTTGCTGGCTCTCAAGAAGATTGTGCAATAATAAACGAATGCGGGGTAAACA
        GCACTCTATTTGACAAACTGTAGACATTTCCCCTAATCGAGCTGACTAAGATCAATAAAAAGCAAACAGAGAAGCACAAC
        AAACAGCGGCAAAAAACAAAAACCAAGAATTCTAGTTTTTGTGCTTTCAGTGTGTGTTCGTGTGTGTGGGCAAGTTGTTA
        CATAAAACAAAAACAATAACAAAATAAAAAAAAAATAATAAAAAAACACCCCAGCCGAGACGCATTTTTCCGCAGTGGAA
        TACTACTATCTAAGCTTCTTTTTGTTTTGGTGTGTGCGAGAAAACGAGTGTGAAGAAAATGCTGTTCAACAAATGTCTGG
        AAAAGTTGTCCAGCTCGCTGGGCAATGTGGTCAATCACAAGCTGCAAGAGAAACAAGTCTACAACAACAACAATATCAAC
        AATAACAATAACAATACGCTAAACAACAACAATGCCTACAACAATCAGCGAAACTTTGAGTACGAAAGAGCCATACAGGC
        GCACTACGGAAGCAAGGGAAGACGCTCGGAGGAGCGCGAAAGGAGCGGCAAGTTCAAGGCCAGCAAGGGTCGGAAAGCAA
        AGGTCACCCCACCAACGGAGACACCCGAGGCCCAGGAGCCGGCCTGCAAGAACTGTATGACCCACGACGAGCTGGCCCAG
        ATCATAAAGGGCGTGGCCAAGGGCGCTGACGCGCAACGTAATCGAGACAACCGACTGCAGCGCAGACGTCGTCCTCTCTC
        CGCCCAACCCTCCGCCGCTGCCTCCGCCTCCACATCGACGGAATCTCTGCACCGTCTTACACCCAGCCCGCAGGCTTCCT
        ACCCGGCCACGCCCACCTCCTGGACAGCCACACCGCCCCAGTTCCCAGCCGCCTTCGGCGGCGCCAGCTGCTCCAACAGC
        ACACTGTCCCTCTTGGCCACCATGCGCGTCCAGCTCCATGGTTACACATGGTTTCATGGCAATCTTTCCGGAAAGGAAGC
        GGAAAAATTGATCCTGGAGCGGGGCAAGAATGGTTCGTTTCTCGTCCGTGAATCTCAGAGCAAGCCTGGCGACTTCGTCC
        TTTCCGTGCGCACGGACGACAAAGTAACGCATGTCATGATTCGATGGCAGGACAAGAAGTACGACGTCGGCGGCGGGGAA
        TCCTTTGGCACCTTGTCGGAACTGATCGATCACTACAAGCGTAATCCCATGGTGGAGACGTGCGGAACCGTGGTGCATCT
        GCGACAGCCATTCAACGCCACACGAATCACGGCGGCCGGCATCAATGCCCGGGTGGAACAGCTGGTCAAGGGAGGTTTCT
        GGGAGGAATTCGAATCGCTGCAACAGGACAGTCGGGACACATTCTCGCGCAACGAGGGCTACAAACAGGAGAACCGCCTC
        AAGAATCGCTACCGCAACATATTGCCATACGACCACACGCGCGTCAAGCTGCTGGACGTGGAGCATAGCGTGGCCGGAGC
        CGAGTACATCAATGCCAACTACATACGGCTGCCCACCGACGGCGACCTGTACAACATGAGCAGCTCGTCGGAGAGCCTGA
        ACAGCTCGGTGCCCTCGTGCCCCGCCTGCACGGCTGCCCAGACACAGCGGAACTGCTCCAACTGCCAGCTGCAAAACAAG
        ACGTGCGTGCAGTGCGCCGTGAAGAGCGCCATTCTGCCGTATAGCAACTGTGCCACCTGCAGCCGCAAGTCAGACTCCCT
        GAGCAAGCACAAGCGGAGCGAATCCTCGGCCTCTTCATCGCCCTCCTCCGGCTCTGGGTCCGGACCAGGATCGTCGGGCA
        CCAGCGGAGTGAGCAGCGTCAATGGACCCGGCACACCCACCAATCTCACGAGCGGCACAGCCGGATGTCTGGTCGGCCTG
        CTGAAGAGACACTCGAACGACTCGTCCGGAGCTGTTTCTATATCGATGGCCGAACGGGAACGCGAGAGGGAGCGCGAGAT
        GTTTAAGACCTACATCGCCACCCAGGGCTGTCTGCTCACCCAGCAAGTGAACACGGTGACGGACTTCTGGAACATGGTCT
        GGCAGGAGAACACGCGGGTGATCGTCATGACCACCAAGGAGTACGAGCGCGGCAAAGAAAAGTGCGCCCGCTACTGGCCG
        GACGAGGGTAGATCGGAGCAGTTCGGCCACGCGCGGATACAGTGCGTCTCGGAGAACTCGACCAGTGACTATACGCTGCG
        CGAGTTCCTCGTCTCGTGGCGGGATCAGCCGGCGCGCCGGATCTTTCACTACCATTTCCAGGTGTGGCCGGATCACGGAG
        TGCCCGCCGATCCGGGCTGTGTGCTCAACTTCCTGCAAGATGTCAACACGCGTCAGAGTCACCTGGCTCAAGCGGGCGAG
        AAGCCGGGTCCGATCTGCGTGCACTGCTCTGCGGGCATCGGTCGCACTGGCACCTTTATTGTGATCGATATGATTCTCGA
        TCAGATTGTGCGCAATGGATTGGATACTGAAATCGACATCCAGCGCACCATTCAGATGGTCCGATCGCAGCGTTCCGGTC
        TTGTGCAAACCGAGGCGCAATACAAGTTCGTCTACTATGCGGTGCAGCACTATATACAGACCCTGATCGCCCGGAAACGA
        GCTGAGGAGCAGAGCCTGCAGGTTGGCCGCGAGTACACCAATATAAAGTACACGGGCGAAATTGGAAACGATTCACAAAG
        ATCTCCATTACCACCAGCAATTTCTAGCATAAGTTTAGTTCCGAGTAAGACGCCACTGACGCCGACATCGGCGGATTTGG
        GCACTGGGATGGGCCTAAGCATGGGCGTGGGCATGGGCGTCGGCAACAAGCACGCATCGAAGCAGCAGCCGCCGTTGCCG
        GTGGTCAACTGCAACAATAATAACAACGGCATTGGCAATAGCGGCTGCAGCAACGGCGGCGGGAGCAGCACCACCAGCAG
        CAGCAACGGCAGCAGCAACGGTAACATCAACGCCCTACTGGGCGGCATCGGCTTGGGGCTGGGCGGCAATATGCGCAAGT
        CGAACTTTTACAGCGACTCGCTGAAGCAGCAACAGCAGCGCGAGGAGCAGGCTCCGGCGGGAGCAGGTAAGATGCAGCAG
        CCGGCGCCGCCGCTGCGACCGCGTCCTGGAATACTCAAGTTGCTCACCAGTCCCGTCATCTTTCAGCAAAATTCAAAAAC
        ATTCCCAAAGACATGATCGGCTTGCGACCGCCAAGCCATGCGCCTGCGTTGCCGCCGCCACCGACACCGCCGCGCAAAAC
        ATGACAAATGAATTTCTAAGTCGCGACGCCCCCTTGACACGCCCCCTTGACACGCCCCCCTGACACCCACCTCCCTCCAC
        ACGCACACAGACCACATATGGTTTTCATTTTAAATGTCACCCAGCCGCCGCCCCAAACCCAAAACCCAATCCCTCGACTA
        TGTTTTACTGTTGTACCACGTTCTACGTTTTTTTTTTTTTTTTATAATTGTAATCTATATACTTTTTTGTAATTGTGTGT
        AATGTAATGTTTAGTTTTATGTTATTGTCTCGCTTTATGTTGTAAGTGTTCCCTGCACACGAAAAGCAGTAACCCCACCA
        CCACCCCAAAACCCAAAACCCAGCATATTTATGTAGTAGTATTGTAAGAATCCCCGAACCGGTAGTTGAGGATACAATCT
        GGGCGGAACTGCAGCAGATCCGCCAAAAAACAAAAACACATTTTTAAGCAGAATCGCAGCAACAAAATATAACACCCGTT
        CCCTGTTCCAAACCGCTTGAATTTGGTGGAATCGGCCTTGATAGTATTTCACTTTCTTGAAAATATTCGCTTTAGATAAG
        AAAATTGACTTGTGACAAATATTTACATGTATTGCGCTGGTTACAAACCACAAAAGTTGCTTAACTTTAAATTTTACGAA
        TCGACATTTATGATATTTCGCATGCTTGAAAATAGTTGTAGTTTCCTATTTGGGAATCATTGAAAAATCCATTTATAAAG
        CGAAATCCAGTTCTGGCACGTTCAATTTGAATCGGTTAATTTCTAATCTAGTTGGCGAAAAAGTGAAGAAAAGTGAAGTC
        CACCTCCTCCAAATTCAACTTGAAACGGAAACGGGTTACCGGTTGGAGTGCAAATAAAGTTTTTAGTGTAGTAAGTGTTG
        ACAAAATCGATAGAGAAGAAATTAGAGGAGTAACTGAGGCAGTAAGCACGTAACGATAATGATACAAAAAGCGTTGATTG
        TGATTCGAGTGACAGCGAGAACAGAAACTGAAACAGTAACAGTAACAGTAACAGATGAGAACAGATGCGAATGGGATCAG
        TACAGAACAGAACAGAACAGCGGAGACGCCAACCGAACAGAACAGAAATGAACAGAAGAGAAGAGAACAGATTAGAGGTA
        AAAGAAAAAGCTAAGAAGCGCTTAAGCGTGTCGTCCCTAGAATAAGAAAACTAATATTACAGCTCCACAGATCCAGATTC
        AGATCCAGATCTATATCTCTAGCAGCCAATTTCTGATTTCCCCTTCCCTCTTAGTTTTCCCATTAATTTAGTGATTGTGT
        GTATATTTTTAATTGTATATTGAAGATTATTTATAGCGATTGTCCATTGTGTTACATTTCAAATGTTCGAAAGAATTGTA
        TTTAGAAAGTTTGTACTTTAGAAATTATGCATTAATTGTGTGTCTGTGTCTCTCTACCCAGTCTCCCTATCTCTGTCTCT
        CTCTCTCTCTCTCCCTCACTGTCTATGCACGAGTGTTTTCTTAACTAAGTTTATTATTTCAACGCTGAAGCGTAATCAAA
        CTATATATGCAATATTTAAGCACAGTACCTTGGGCGCTGCAAAGAAATTAAAAAATTTTAAAATAAAAACAAACTGCTAA
        ATCATAAATACAAAATATATACAGGAAGGAATAATAGCAGCGAAATGTAAATCAATTAGATTATTGTGCAAATTTGAGTA
        ATATATTTAAAACATACCCTTATTTTATCTTATTTAACTTTATGCTTTTGTAAGTGCTTTAAATTGTTATTCATCTTGAT
        CTTGCAAAAAAATGAAAAAACCACAAAACTGAAAAACGAATACAAAACTAAAAAACAACACAAATTATATTTGTATTTAT
        ACAGAAAAATAAAACATTTTATATGCGATACACGATAGCACATTATTTTTTATTTTCCCTGCATGTTTGTTGAACGCTTT
        TCCCTTTTTGGTTCTCAACTTCAGTTATGTTACCACACATCACCAACGAACTGAAAGAAACCCGAACACTTTGGAACATA
        GCCTTATATAAAACGCCTCGACGACCAAGACGGAAAGTTGAATCACACCACGGAGAAGAGGGAGACATCTCCCCTCTCCC
        AGTTAGAACAATAAGTAATCATGTGTTCACCCCCACCACCCACACGAATCTAAACTGACCCCTGACCTTCCACCAAAGAC
        ACTAGAATAATATTATTCTAATGTCTTTGCTTCCACCCACCATCTGAGCACTAGCGGGTGATCCCGATCGGACGACAAAC
        GTGTGTGTAAGTGCGTGATCTAGTACTTTATATAGTTAGCCTATAATACGATTATTCAAACGGAATATGTCGAAGCCTGG
        CTTCGACTGGGCGGCGACCTAGTGGCCCCCAAAAAACGAAGGTGAATCCGAATATGAATCCCACTGGGGATACGATATGT
        TTTGATCTTGGAGCGCGGGGCGAACAAAGTCGCGCGCTTCTTGTGTTGAATTTTTATAGCATATAGAAAGAGGTGGATAT
        CGGATATGGATATTGAAGAACGCAGTCCAATGGAGCAGCCGGCGGAGGGAGAGATGAATGCCAAAGCACAAAAGCCAACA
        GCAACAAAACACCAATAGGCCTCATCGCAGTCATTTGACCACAAATCTGACAAACAACGATGTTATAATCAATAAGAGCG
        AACCAAAATCAAAATAACGACGTGAATATTGAGGGAGGGATCGATGGAGACCCAAACACCAAAACAAAAAAAAAAAAAAA
        CAAAAAAAACAAGAGCAAGGAAACGCTTTAAACTTAAATAATTCTAAAATTGTATCTAGGCAATATCGAAATGTAAACCA
        CACACCAACTATCCATAGTAGACAAACAAACAAACACCAAGAAAAAATTGCTTGAGTGACTTACTTTAGATAACGATATT
        CTCGGGTAGGACCTCGAAACCCCAGCAACCTCGGACCTCAACCGATTTCCTCGTGCCCTCGACCCGAATCCAACCCAACG
        TCCCCTCCTCCAGTACGTCTATAAGCTAACCACGCGATCCAACCTCAACCCGTGTTCATAATCCGATGAGAAGTTGTGCG
        ATTTTTAGTGAAACCTCGGTGCGGTTTCGATGTTGCAAGAATTAAAACCAAATAGAGACGACGTTTTCTTTGTTCAAATG
        TTGCCAATTTGCAAAATACAAGTGTTAAACTACCATATAGTATATGGAGTATGAATAATATATATTTAGATGCGAAATAC
        AGCTCAGTACTCAGCTCAGAAGCATTTTCATTGAGCCCAAAACGAGACGGCGAGGCAAACGTTTATGTATCGGTATACAA
        GAAGCAGCTGAGAGGTAGTTCTCCTGCCATATAAAATATTAATCGACCCAAAAACATTAGAAATCCGTGTAGAATACTGC
        GATTTGATTGAAACTATAGATAACAATCGAGAACAAAATGGTAAACGAGCCCACGACGAAACGCGATTGACGCAATAAAC
        AAAGTTTTCGTAGCTCTAGATCGTAAGATAAACAAATTAATGAAACGCAACAAAACGATCGCGAAATCGAGACAAAAGGC
        AACACCAAATAAATTGTAAACAAAACCAAAGTCGTTGTAATGTTGAAGCAAATCTATATGTAAATCAATCTGCAAGCGCT
        AACTAAACGTAACAAACATAAAAATTAAACACAGCCACAAAATATTATTATGAAATTAAATTGAAACCTTAAGATGCATA
        GCTGTTCGAAACATTATACCGATAACAATATTGAAGATATATTCTACATTTTTATGTGTCTGCATATTTGAAAGAAAAAT
        ATATATAATTGAATAAACCATATTTCAAATAACCTTTCGGAAAATTACCATGTGTTTTTAGAATGAGTGACTACTACCCA
        CATATTTGTTTCAATATCCACATATTTGGCAAGAAGGTACGAAATGAACAATTCCAATAAAACT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0070378
        4560
        FBtr0070380
        4106
        FBtr0333260
        7119
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0070363
        945
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0070362
        841
        FBpp0070364
        682
        FBpp0305458
        894
        Comments

        Based on alternative transcript reported in U19909; not supported by existing EST data.

        Extended 3' UTR based on RNA-Seq and/or EST data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG3954-RB
        Secondary FlyBase IDs
        • FBtr0005596
        References (2)