Open Close
General Information
Symbol
Dmel\CG2841-RA
Species
D. melanogaster
Annotation Symbol
CG2841-RA
FlyBase ID
FBtr0070404
Feature type
Associated gene
Evidence Rank
Length (nt)
4599
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 59 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CCTAAATCTATCAAGTCGACTTTAGAACATATTTTGGAAATCGAAATTGTCGTTTTTTGGGAAGCACAGAACAAAAGTCT
        TTTCGTTTGGCACAGATTTTGCAGCGCACAAATCGCACGCCATTTTTTTTTTTTAGCATGCTCTACGCATATTACGAAAT
        TCGATCGAAATTTTAAAGCAAACGGCGAGTTTAAGAAATTAGGACACCTTTAGACAGGAAACCAAAAGCGGAAGTCGGTG
        AAGGAGGAAGAAGAGGATAACGAGTGAGAGTGAGAGAGAGAGAGACACTAACGAAGCCACGCCCACGACATGAGCAGCAT
        GAAGGGCAGCTTCGCCACACTGAACCGCTGGTTTGGCCGAAAAAAGGACAAATCCGGCACTGGCAACTCCTCCATGGGCA
        AGTTGTCCAAGTCGTCGACACAGCTCCACCATTTGTCCACGGACACGGACATCAACGAGACTAGTCAATTGGAGTACAAC
        CGGATAACCCCGGTGCCCGCGGCAACCAGCAATGCGCCCTTTGAACAGACCTTCCGCATCACCGTTCTGCTGCCGAAGGA
        TCAGCTCTTCGTGGCCCGATTGGGAGCCAGAGTTCCACTGAGTAAGCTCTTGTCCCTCGTCTGCGACAACAAGCAACTGG
        ATGCGGACAAGTACGAGTTTCGCAGTCCAGTGGATGCTAGTCAGGTGTACAGCTGCGAATCAACGATCGGAACAGTGGGT
        CTCTCAGAGATCCGACTGTGCCACAAGTCGGAGTCCTATGACAACTTCAATCCGGACGTAATGCACAAATTCCAGCGCAC
        CGGTGTCGCTCGAGACTCGTTGAGCAGCAGCTCGGACTTCAGTAGCAGCCGGCACTCAAAGGTCACGGCCAAAACGCCGA
        GTCCGTACAGTTCCAGCAACTCACTGAACTCCATGGACTCCACGGGAATGAACTACACTCGTACCCCGGTGGTGGTGCCA
        CCAGCAAAGGTACTAGCACCGCCACCCCGCAAAAAGCGAACCGCTCCTCGGCCGCCAAGCCAGGTTTGCATTCCAGAGCA
        GTCTGTTCCGGATATTCCAGCTGCTAACTCGAAAAGCGAACCCGCTTATGCGGTAATTGTCAAGCGCCCCCAGCTCTGCA
        TGTCCACGCCCAACCTCTCCGGTCCCTTGGAGTTGGACTGCAATGGTAACGGCTCAAAGTCGCCGGATGAAGACTCAACG
        GATGGCCATTATGCTACACTGGATCTGAAACCTCCGATTGCTGGCGGTCCGGAGCCAACGCCTCGAAAGCGATTGCTGCA
        GATCAAAAAGAAAACGGCACCGGCTCCACCGCCGGACTTTCAAAGTGGGGGAGACAATATATCACTGGCCTCACTACCGG
        AACCGGTCACACCTACCCCGAATATTCCGCAACCAGCGCCTAGGATAACCACTCCCTTGCCCATTGCCCCGACAGCCAAT
        CCTCCACTTGCCCAAGTAAATGGCAATGGCAACGGATCACCGAATGGAAACGTGTCCAAAGTCCTTCTGAATAGAACGCC
        CACTCCGGAGCCCCGATCCCTGGGCAGTGCCACAGAGGATGATGACAACGATACGGCATCAAAGCAAGCGGATTCGGGAA
        TCGGAGAGCCAGCGCCATCGCCATCCGTCTCTCCCGAACCAGAGGCGGAGAAATCGCAGCAGGAATCGAGTTCCGAGGAC
        GATGAGGCAATCAAGGTGTACAATTTCAAGCTGTGCCAGACATCCAAGAAACCTGAACCATCGGCAGCCACTTTGGCGGA
        ATTGACAGCTCTGACAGCGCAGGATATCGAGGAGGAGGACAATCACGTGGATCAGCCAGCGAGCATAACAAATGGAAATC
        TGGCCACTCCCAGTAGCGAAACATCGCTCACGTCGTGGAACTACTTGGATCCCATCTCTCCCCCTCCCGACTTCTCCGAT
        CAGCAAATGCAGAAACGCAATGCTGGTTCGTTAAGTCCTGGCTCGCCGCTAGACGAGATCGTGGATGAACTGGCCACTAT
        AATCAACCAACAGCGTCTGGATACGTTGATAAAGAAACAACCCGATCCCCAAATGGTTGAAATCGAATCGGCCAAACCAA
        ATCGATTGGCTAACTTCAGCATAACTACGGCGAAAAGTACGACGAGGATTGGACGAGCTGACTCCTTTCAGGCAGGCGCC
        TCAGGCGGAGGGACAGAGGTAGCCTCATCCGGAAGAGCTCTAAGTCATCGCAGCTCTTCTCACGTCTCCCTAAACAAGCT
        GGAGCAGAATGGCATTGGTTTGGGTCAGAGACGCTCGTCTAGTGAGTTGAGCATTGGTGAATCACCATCATTGCAAAGTC
        CAGAGGTTATCAAGACCATTCTGAACTCTAGAAAGAACAGTCTGGCCGAAAGTGGAGGCAGTGCATCTACTCCTGTTACA
        GAGCAACCAAAGATCATTAAGCAGCTGGAGAGCCTGGCCAAAGAACAATCATCAGTGGATGGAGTAAAAGACATCAGTTC
        CTCTCGTTCTGAAGCTTCGCAACAGTCACCTACGCCTGTCCCGAAAAAGTCGAATCCTGGAGTTGAGAAACCTACATCTC
        CGACTTTCAGAGCTGTGCAGGAACCTTATCCGTCTTCTCCTGCACTGCAGAAGTCATCTCCTGCCGTACAAGAGCAGAGA
        ACTTCTCCAGTTGAAAGGCCATCGTTACCTCCAGCTGTGAAATCTGTCGAGGAGCAAGCTGTTTCGTTGCATCAAAAGGA
        GATAGTTGTACAGAAAGAATCGCCGCCACTTGAGTCCATGAAGGAGTCATTTGTTATTGTGTCAAAGATGTCTCCGCCAG
        CTGTCAAGAAGGTCCCAGATCCATTCCCAAAAGTTGAAGCAGTCAAGGAGGAATCATCAGGCAATGAGAGCTCCCAATCC
        ACGATAACTCCTCCAAATACCCCAGCCACTCCAGTCAGTCCGGTTAATTTACGAAACCCCAATAACACAATGGCGGAAAT
        TGAACAAAGCCAGCGGGATGAACCAGCTCCGAGCTCCAAGCCTCTGCCAACCACATATCGGTATTCCGGACCACCGAGCA
        TTAATTTCGCCACCTGGAGCGAGCGACCCAAATCCACTGTGGCCATTAAGAACGAAGGCGACTATATCTTTGGCGGGGCA
        GGGAAGTCGCAACAGTTGACTTCACCGCCTTCCAAGCTCACCATCGGAGTGGCTTCACCCATTTTGAGGATGGGTATTCC
        GCAGGGAAAGGAGTATCATGTTCCCATTACGGTTAAGCCACTAAAGGATGAGATTTTGGAAAATCAACAGCAGGAAAAGA
        AGGAGAAGCCGGAGGTCCAGGAGCTAAAGGATCAAGAAATCGAAAAGGAAAGTGTTTCAGTTAAAGTAAAGCCTAAAACG
        CCGGTGAAGCCGGTACAAAAACGTATAGAAAAACCACTGGATCAGGACCAAAACTCCCTTCAAAACCATTCCTCTACATT
        GCCGCGTCCAGCCAAAAGCAATCGATTCACTCTACCCGCTGCCCAAAACAACCAAATGGTCTCCCACTTGACCATGAACT
        CCCTTCCACGCCCTGTTTCCAGTTTGGAGAGGAACAGACCAGTGGAAGCCAATCCTGCACCAGCGCCCTTTGGCCAGAGT
        ACTCTACGCCGCACAGGCTTCAAGGAACGTATGTTGGCCAAGGAGCAGCAGGAACAGGAGCAGGCCTTGAGAATAAGGGT
        GTCCGTGAACGAAAGCATTCCTTCTTCAGCTACCGCGCCCAAGTCCCCGCCAGAAAGCAAACCAGCACCGCCGTCAATAA
        GTGGCTACGTCGCTCTGAAGTCCACCAAAGTGGAGGTAAAGCTCCAGGAGCCAGAAACTAAGCCGGTGAGCCTGCAGGTC
        AAACTCAAGCCCACTGTCCAGCCAGCGACCACACCCTCCCCTCCGCCGCCGCCTCCGGCACTGCAGCCCGTGAAAACCAA
        CGGCGGACGCAGTGGTCCCACCGCGCCTGATCCGCGCTCCCAACTGTTGGACGCGATACGGAACTTCAAACGCGAGGACC
        TCAACCGATCCTAAGTTTTTGAAAGTGAACTGAGGAGAGTCGGGCAAAAATTATTGAAGCAGCGCACAAGTTATATATTT
        TTTAAACCGTTAACAATACATTTTGTGTTGAGTTTGTATATAATTTCGATAAAGCCAAGATTTAGTAAAACTTATTTTCA
        CCTCATCCCCGTGCTTTTAAAGTGCCCCCCCCCCCCACATTTTTTTAACTAATCTTAGTTTTTGTTATGAACTATGTAGT
        TTTTTAAAAGTTTGTTTTAGTCATTAGGTCACAAGAGAACCCAAAAAATTAACAAGAAAACGAAAAGCGCAAAATTTATC
        TATATAAATATATATCTATATATATATATGTATGTTATTATGCCGATATAATATTTCTTACGTCATAGTGAAATATAGTA
        ACCAATTTTCTAACCAATGGGACTGGTCTACTTAGTCGTGTCAAATAAATAAAAGCAAACGGTAGCGAAACAAACTAGCC
        CAATACCGAGAGTTACTAATGCTAATAAATTATTTTTAAACAACTGCAGTTAATGCGCTGATGTGTATATATATATATGG
        CATTGTATTAAACTGAATAAAATAAAAAAATAAAAACAG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0070402
        4269
        FBtr0070403
        5069
        FBtr0307284
        4955
        FBtr0307285
        4207
        FBtr0343597
        4653
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0070388
        1234
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0070386
        1234
        FBpp0070387
        1234
        FBpp0298285
        1234
        FBpp0298286
        1234
        FBpp0310194
        1239
        Comments
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG2841-RA
        Secondary FlyBase IDs
          References (2)