Open Close
General Information
Symbol
Dmel\Rala-RA
Species
D. melanogaster
Annotation Symbol
CG2849-RA
FlyBase ID
FBtr0070583
Feature type
Associated gene
Evidence Rank
Length (nt)
2377
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 98 )
Sequence
TCCACTTTCACACTAGTTTCTTTCAAGCAAGCAAAACCAACGGAACTTTAATTGCGGTGTGCGGCGAACGAGAAGAGAAA
CCGAAAAGCAGCCAATTTACTGTTGCGTTCCGATCCTGTTAATTCATCAGTTGCCGATTCTCCGATCGCGCCTGTAACTT
TTTTGTTTAGTTTAGTGCATCAAGTGCGAGATAACACAGCAAAGCAACAACAAACGAAGCGACAGGCCAAAGCGGACGCG
CAAAATACAATAAAAAGGAAGGAAGAAAACGAAGTATCGCTATCTGCAAAGGCAGATCAAACTTGCTCGGCCAAATAAAA
ACACTTTGTAAATGAGTCTGAGCCACGCAGTTCGCTTGACAAGTTTTCCTCGGCTTGTCCAAAGAAAGTTGTAACAAATG
TACATCAAATGAACAAGTTTTACCCAACACTTTCTCAGGCTAACAAATACTCTGCAGTTTCTGGCAGGGATACAGCGAGT
GAGTGATCCCGCCATCATGAGCAAGAAGCCGACAGCCGGACCGGCGCTCCACAAGGTCATAATGGTGGGCAGTGGCGGCG
TGGGAAAGTCCGCCCTCACACTGCAGTTTATGTACGATGAGTTCGTCGAGGACTACGAGCCCACCAAGGCCGATAGCTAT
AGGAAAAAGGTTGTGCTGGACGGCGAGGAAGTACAAATAGATATATTGGATACGGCTGGCCAGGAGGATTATGCCGCCAT
CAGAGATAACTACTTTCGCAGCGGCGAGGGTTTCCTTTGCGTCTTCTCCATCACAGACGACGAAAGCTTCCAGGCAACCC
AGGAATTCAGAGAACAAATCTTGCGGGTGAAGAATGATGAGAGCATACCGTTCCTGCTGGTGGGCAACAAGTGCGATCTG
AATGATAAGCGCAAGGTGCCGCTGAGCGAGTGCCAGCTGAGGGCGCAGCAGTGGGCGGTGCCCTATGTGGAGACCTCGGC
TAAAACCCGCGAAAATGTGGACAAGGTATTTTTTGATTTGATGCGCGAAATAAGATCACGAAAAACCGAAGATTCGAAAG
CCACGAGCGGGCGTGCTAAAGATAGATGCAAGAAGCGGAGACTTAAGTGTACCCTACTTTAGGCATTAGGTATTTTATGA
TCTAATCAGGGATATTTCATCGCGTAAAAAACAACGTCAGACGGACGTGAAACAGCCGCCGAAGCCCAACTCTCATTGCT
GCCAACTGCTGTAGGATGATGAAGAACAACAACGGACAACAACCATACGATGAACAACAAAACAACTGCAGCAGCAACAA
ATTGGAAAATAACACAACGGCCACACGGATGATAACACCAACACACAGGATATGAAGGATATGGAGAACGGAACCATATG
TTAATACAATTTAATTAATTAACTTTGAGAACACCAGTACACACATACGAACAGCAACAGATATTAAAACTATTTGCCAC
ACTCAGAAACTCAAAATCCATAATCCACGTTAACTTTCATTGTAATATACATAAATATATATATATATATATATATGATT
TAGGCAACAAGTTTTTTTTTCGAAAACATCAAGCGAAAAGCACACAGACGGGCAACTTACGAATTCTGTCGTTTATTTTT
GGTTACTTATTTTTTTTTTTTTTTGAATCATCGATGTTTGTTTGTGTTGCCTCCGTAAAAAAAAAATGTTAAAACTAAAA
CCTAAAGCTGAAGCTAACGCTTAAACATATTAAATATAATCATCAATCGTAGACAACTAAAGAAGCCCATAATAATTATG
CAATTTAAAACTTGCTACAGATATTTCTCTTGTTTAATTATATATACGCATACATTTTTTTGTAATATTTTTAAAGTTTA
ATAGCAAAATGCAAACCACACAAACCAACAAGAAACCACACAGAAAAGCTTTTTATAAATATATCTAAATATATATTTAA
ATATATATAAAATAGTATAAAACACTTAAAATCCTAGCGAAGAAACAACAGAGGAAAGCGGGGAGAAAGAAAAAACAGAA
AAACAACAAATATCTCCAATTATTAATTGTAAACGAAGTGAATCGAAACAAATTTTTAATGCAATTTTTGTAATTTTCTA
AACCGAAAGCAAATGTGTAGGGATTTATAAACAACAACAAAACCAATGAGTAATAATGGTACACACTAATGTTTCTGACA
AGCTTTGGAGACTTTCCGTTACAAATAGTTATTTTCTTTGCCCTGGAACACATCCAATATATGTATATGTATGTATGTAT
GTATGTTTAGCAATTACTCCCGATTGATTTGCTTCTTTGTTTACTTTTGTATAACTGCATTCTGTATTGTAATATTTAAG
CTATTATTATTATGATAATTATTATTATTATTAAATATATAAGTTATATATGCAATC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0070582
2057
FBtr0070584
2555
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0070558
201
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0070557
197
FBpp0070559
201
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG2849-RA
Secondary FlyBase IDs
    References (2)