Open Close
General Information
Symbol
Dmel\CG3009-RA
Species
D. melanogaster
Annotation Symbol
CG3009-RA
FlyBase ID
FBtr0070688
Feature type
Associated gene
Evidence Rank
Length (nt)
2475
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 24 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    GTTCAGTTGCGCCGCAAACGCGTCGCGGAAATGTTTCGCTGCTTCAGCTGCTGCTGCCACCGTCCGAAAGAAATCGAAAT
    CGAAACCGAAATTTAATTTCAATTTTCAATAAAAATTTAAAGCCACAATTTAAGCAACGCGCCGCCGTCCTCTTTGAATT
    CCGCATCCTTGGCAACCGTTACCGAATTAGAACACATAGTAAAACCCGATACAACGAAACGGGAATTCAAACCGTTTGAT
    AATTTACTCCTTCCTCCCTAAAGTTCTCAGTTGGCGCCATGAGGGAACCACTGCCCGTGGCGGTGGTGACGTTGCTCCTG
    TTCCTGTGGCTCGGTTCGGCGATGCCACCCACATCTGGTTCGGCGGTGCTCATCTCCGACATGACCATGAGCGTCATGGT
    GGAGCTATCCTCGCGACATCCCTTCTGCAAGATGCACACAGATCGTGGTGATATCCAGCGCATGTTGCTGCAATCGGATC
    CGCGACGCATACGCCAGGTGCCGCGGGAGTCGGTGATGGAGCTCGAGGAGGTGTGCCGCCGTCAGGGATCCTATGGCCAC
    GAGTTTCGCGGCGGACTGGGCTTCATCTATCCGGGCACAAAGTGGTGCGGACCGGGCACAGCGGCCACCAGCTACGACGA
    TCTCGGTGCGCACGCTCGCGAGGATCGCTGCTGTCGCGAGCACGACATGTGTCCCGATGTGCTAAATGTGGGCGAATGCA
    GGCGAGGATTGTGCAATCGCGGCACATTCACGAGAAGCCACTGCGATTGCGATGCCCGGTTCAGGCGATGCTTGCAGGCG
    GCAAACACGGAGACGGCCAATACGCTGGGCGCCATCTTCTACAATGTGGTGCAGGTGACGTGCTTCCAGGAGCGGAGTCC
    CTGCTCGGCACACCAGAGGTTCGAGGACTTCTACTACCGCACCGATCACTGTCCGGCGGAATTCCGGCAGGCGGATCTCT
    ATGTGCCGCCGCACGGTGACAATCTGATAGCCAAGATCCTGGCCCATCCGCAGGGCCGGGCCCTGGCCGCTCCGTCCTGG
    ACGATTCCCGCCAAGTCGACGGCGCGCCGTTGGGGCGTTAAATTGGCCAGCGTTGGCTTGGCGGCGGTGAATATCCTGCG
    GGAGGTGGTGCAGCGACCCCGACTCCTGTGGGATAGCCTGCAGGCGCCGGTCTCCAGGGAGCTACCACCGCCGCAAAGAT
    ATCACGATCCGGGCTATCACTACGAGCGACCCGGACCCGGCTCGTCCTACGGATATGGCCAATACAGTGGTCGCGGTTAC
    GGGGGCTTCGACTCCCCTTGGAGCTAATTGCGGTATCACGAATGCCCCCGGAAGACTGTTCTGAGCGATTGGGTGGAGTC
    CACTGGTCACGCGAAAATATGTTCCGTATGGCGAGTAATCCAAAAGGCAGTTGTAAATGATATACAAGTACATACTAGGT
    TAGAGATTAGACAGGATTAAAGATAGACATTCAATTGCCAAAGAAAAGCGCAGCAAGTACACTTTAAGAAAATATCGCTT
    TCATACTTCGAAACGTGTGTATGAAGTTAATCGGCGCGAATTCTTTGTTTCATCCTGTTTTATATTCTGGTAAAGTTTTT
    CATTCTGTCGGTTACTTATTATTCTGGAAAAGTTTCACTGTCATCAGATTTGCCATCTTCGCGTGGGAAGAGAATGGGAA
    TTGATACTTTAAATGGGTTTTTTTTTGTGTAAGATAACCTTTTGTGAGTCACTAAGTGGTAAGGTAGAGAGATAGCTTTT
    AAGCAGACATAAACTTCATTGTACCGATGCGTATTTTTTTTTTTAACAGAATTTGAAGATTACTCTGCCAATCGGTTAAC
    TATTTGCTAGACCACACATGGATTGAACCGCCCAACTGCTCCCGCTTAGTATTAGTAGTCATAAGTTGCAGTTACGGCTC
    CGCTAGGGAGTCGCAATCCTAGCTAACTTAGCTGCATGTGTGATTGCCATTAACGTTATGCATGTACCGTGTTCACTAGT
    TGACCATTTGACCATTTGACAGTTGTGCTTTAGAAATAAACTCACTGAGAATTCGCATGCCTGCGCTCTTCCTTTCCGGT
    AAATGAATTCGATTAGAGCCGGATACAATCAAACGGAACAGGAGGCCATCTGCGCCCAGTGGCAGTATCAGCCGTCGGAG
    AAGTATGTGCCCAGCCAGCCGAGAACCTCATCCTAAATGGGCAACGTTGACGACCTGGACCAGCTGATGGACTCATGGAA
    TCGGTTACAAATCTACACGGCATTAGCTTATCGCCTAGCTATAGTTATCCTCGATTGCAATTCTTAAACCTGAACGAAAG
    CCAAAGATCAAAACAGTCGCTCGAAACTAGATGGGGAAAATATATATACACATATATATTTTCATATATTGAATGCATAC
    AAAACAGATCTATATAAATGTATATATATGTATACACACAAAAACGTACATATAAATAAATATATTTACCATGAC
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0300468
    2056
    FBtr0332316
    1277
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0070656
    342
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0289695
    342
    FBpp0304595
    239
    Comments

    Transcript terminates at site supported by polyadenylated cDNA.

    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (1)
    Reported As
    Symbol Synonym
    CG3009-RA
    Secondary FlyBase IDs
      References (2)