Open Close
General Information
Symbol
Dmel\Rnp4F-RB
Species
D. melanogaster
Annotation Symbol
CG3312-RB
FlyBase ID
FBtr0070753
Feature type
Associated gene
Evidence Rank
Length (nt)
3242
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 30 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TATTCACACTTTACCGGTGTTTCTTGACAGAAAATGATAAGTTTTCGTTAACCGAATTCTCAGAAACGCAACAACGCGAT
        ATTAGATTGGCCAGCCCTGCGTTTGCGGTTTTTTTTTTGTTTTTTTATTTCCTGTATTTTTTTTGGGGGGGAAAAATTGC
        AGTTCCACGGAAAGCGAAAAGTTTTCCACCAAAATAAACGGTTGAAGCATGGACGCCGACAAGCAGCTGGAAAGGCAGCT
        GGAGAAGGAGCTGGACGAGATGCCGGCAGAGGATTTGGACGACGATGCGTATGACGAGTATGATCTGATCGTGATACCCG
        ATCAGGGCAAGGGCTCGCCGCAGCAGGGGCACAGTGAGTCGCCGCAGCAGGAGGAGGAGCACAAGTCGGAGGAGCTGCGC
        CAACGATCGCGCCCAACCTGGCCACCGTCGTCCGCCGGCGGGGATATGACCACCATTGAGTTGATCTCATCGGACGACGA
        GCCGTCAGTGGAGGAGACTGAGGGAGGCAATGCCGCTGGCCGTGGCAGAGCGCGCAATGATTCCAGCAGCAGTAGCGATG
        ATGTGGGCGTGATCGAAGGCTCGGAATTGGAATCGAACAGTGAGGTGTCCAGTGACAGTGACAGTGATAGCGACAACGCT
        GGCGGCGGAAATCAGCTAGAGCGCTCGTATCAGGAGCTGAATGCGTTGCCCAGCAAAAAGTTTGCCCAAATGGTCTCGCT
        CATTGGAATCGCATTCAAACTGAATGATCTGGAAAAGATCGAGTCATCGGTGCTGGAGCTGCAAAATTTGGCCACTGTGC
        CGGCTCACGTGTGGCTGAAGTATCTAAAGGCCCGCCTGGTCGTCACCCAAACGGACGAGGAGCGCAAGGCATTCGAGGAG
        CAGTGTGCCAAAGCGTTGGGCTACTACTACAGCATACCGCTGTCCGAATACGTTGTCAACTACCTGGTGGATCAGGGCAA
        CGTACAGAACCATGTGCTGTGGGCCAAACTGCTGGCGGACTACGACGTGGAGCGTCCAGACTTTGGCGACAAGCTGCGTT
        CGCTGATATCGACAATTACGGACGAAAATGAGGCTGCCGCCTTTGTGGAAATGCTGCAAAAGCACTGCGTCACCTGGACG
        TGCAACGTGGAGCAGCGGCAGATGATCAAGTCCGTTGTGGACAAGTTTAAGCAACATCTGGACGAGACAACGCGTGGTTG
        GGATTGGTCTGAGCAACACAAGGCTCATGTCTACGATGTGGAGACATTATCCCTTGACGATGACCTCAAAAACGCTGTGA
        TCCGTTTCATATTCGAACGCTCGGTGGCCAAGTTTCCCATTGTCGATGTGCTCTGGTTATCCTACATTGAGTTCATTCAG
        TTCGAAGGCGTCACTGTGCCGGAGAATGAGGATGAGAATGAGGTAACCGCCGAAATGGTAGCCAAACGGGCCAAACGCTT
        GGGCAAAGGTTTTCTGCGCAACACGGAACTCGATTTGGCCAATCGTGGTGTGCGCAGTCATCCCAGTGTACAATTGAATC
        ATCGTTTCCTCGACCTAATGGAGCGCTCGGACTTTGAGTTGGCGGAAGTGGATGAAGAGATACGTCTCATATTGCAGCGC
        ATTGTGACCGACATGGATATGACCGTGGAGCTGCATCTGGACTATCTGGCCTATCGTATTCGCAACACCAATGCCAGCGA
        TGAGCAGCAGGTCGCCAGTCTGCGTGCCGCCTTCAATCATGCTTGGGAGGAGCTAACCGTGCTCTACGGCGACCAGGCGG
        ACACCAGGTACGAGGTGCTGCAGTTGTGGGCCCAAGTTGAGTACACGCAACTGGGGAGTCCGGACAATGGCCGTGAGATT
        TGGCGCCAAATAATGGGCTATCCGGGCAGCTCGATACGCGGCCTGCTCTGGCTGAACTTTGCCCAGATGGAAAGCGAATA
        CAATGGTGGCCACGGCACACGCGATGTCCTTCGCAAAGCTCTCTCGCAGCCCGTCCTCGAGAATGGCCTTATGGTGCAGG
        AGTTTTTTCGCCGCTATGAACGTTGCTATGGCACCTACGAGTCCATTGCCGCCTGCCAGGCCCTCGATCTGCCTGTCGAG
        TATGTGAAGCCGCGTTCCCGCATTAAGCCCAACTCACAGTCGGCTTATCCTCGCCAGCAGAAGCTTAAGCCGCGCCAGCA
        GCAGCAACAAACGAATCGTGAGCCACTGAATCGCGAGCAGCGACGTCGCCAGGCGCATGAGCAACAACAGCAACAGCAGC
        AGCAGCAGAAGCATGGCATTAAGAAGTCCAGAACCGAGCCATCTGGTGGAGCTACGTCACCGCCATCGAAAGTCAAGGGG
        CCAGCGAATGCAGAGGCCAAGGAATCGAACTTTAAGTATTCGCCCAACATGGAAATCAATAAGATCTTTGTAAGAAATCT
        GCATCCCGCTTGCAGCAAGGAGGAGCTGCACGAACTCTTCTCGCCTTTCGGCACCATCAAAGATGTGCGCCTGGTGCACA
        AGCTAAACAAGCAGTTCAAGGGCATTGCATACGTTGAGTTCGAGAAGCCGGGCGAGGCGCAACGAGCAGTGGCTGGACGA
        GATGGTTGTCTATTCAAGGGCATGAATATCTCTGTGGCCATTTCAAACCCACCGCCGAGGGGCACATCAGCTGTCAAGCC
        AAGTGTGGCGCCCAAGCGACGTGTGCCCACCTCGCTTATACCCACGACTCTGGTGCGCCAAGAGGTGGCTGCCAAGAAGC
        TGCGCTTGCTTCTGCCCGAGCCGGGGGACATATCATCCACTTCGGCATCCGTCGACGTGGCCATCAAGCGCGAGGCTAAT
        GGAGAGGAGCAAAAAGGAGATGTTCAAGAACGAGATGAGCAAAAAGGAGAGGAGCAAAAAGGAGAGGAGCAAAAAGGAGA
        GGAGCCAAAAGGAGAGGAGCAAAAAGGAGATGATCAAATAGGAGAGGAGCAAAGTGGAGTGGAGCAAAAGGGAGATGAGA
        AAAAAGAAGAGGAGATGCCAGCTGCTGTGCCCAAGTCAAACGATGACTTTCGCAAGCTATTTCTCAAGGATTAGGCGACA
        AATGCCGGCGGCTGAGCCCGGTGCCAGCGGCCATGGTTTAGTTTGTAAGACGAAGACGAAGATTTGGAGCATATATTTTT
        TTAGATTTAAGGCAACCTAAACAGACAAGGTTGGAGAACACTGTACAAAGAGAAAAACTGTTGTAAGACAATGATTTTTG
        TTTCGACTCATATAAATTGGTTTCTTGATGAACCAAGTGAAG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0070752
        3323
        FBtr0112876
        3146
        FBtr0340477
        3116
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0089396
        941
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0070720
        941
        FBpp0111789
        941
        FBpp0309418
        941
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG3312-RB
        Rnp4F-RB
        Secondary FlyBase IDs
          References (2)