Open Close
General Information
Symbol
Dmel\Usp16-45-RD
Species
D. melanogaster
Annotation Symbol
CG4165-RD
FlyBase ID
FBtr0070772
Feature type
Associated gene
Evidence Rank
Length (nt)
4117
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 44 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AAGCAACGGTCACACTTGGTCACGTCGTTCACGTTTTCTATTTACGCATAAACGAATAAAAAGCGCCTAAAAGTGCTATA
        AAACATATATGTTGTGTGCTCATGTGCTACACATATCGCAGCGAGTAAATTTAAGAGCGCGCCCACAAGGAGGCCAAGGC
        CAAGCAGCTACCTTGCCATGGTAAAGAAGCGTCAGGCGGACAGTCGCGACCACGATTGCTCAACGGATTCCGGCAATGAG
        GATCTGCATCATCGAAAAGGACTCGGCTCGCCCGGTCAGTCGGATGGCGCCACCCCCACCACCGCCAGCTGCCAGCACAT
        CAAGAAGGCGGTGGACGCGGCCCGACTAAGGCGTCTACTGAAGTCCACGGGTCTACTCTACGAGTGCAGCCAATGTCAGA
        AGCTGGGCAAGACAGCGGGCAGCGCTGCGGGAGCGGGAGCGAGTGAAGGAGCTGTCGGTCCTGGCGGAAATCCGGTCACC
        TTCGAATTTGACAACACCCTGTGGCTGTGCCTCAAGTGCGGCAGCCAGCTGTGCGGGAGGGCACGCCACAAGCACGCCTT
        AGAACACTACCAGACACCTCATTCGGACTCACATGCCCTGGCCATGAATACGCGCTCCTTCGACATCTGGTGCTATGAGT
        GCGACATGAAGATCTGCTCCAATCTGCGCAAAAACCTGCTTGAGTGCGTGGAGCTGGTCAAGAAATTGGCCCAGAAGCCG
        CCCACTAGCACGGTTACGCCCAGTACGCCAACGATTAGCTACATCGAGGAGAAGCTTAAAGCCGCGCTGGAGCATCTCAC
        ACCAATAGTGCCAATGACTGGCGGATCATTTGACGACTCCAGCAGTAGAGGGTCTCTGGCGGCGGCCGGTGGCGGGGGCG
        GGGTCGGTTCATCTCGAAATAGGCAGGTGGCCATACCGATGCCACCACCAGAGCCTAGCTCCGGACTTTCGACCTCAGAC
        TCGCTGACCAGTGTGCCGGGTATGGCAAAGAGAATTGACCAGTACTCGGCCACCACCAATGGCAACACTGGGAACAAACG
        ACTCCTGACCCTAGAGACGCCGCGCATCGAAAATGAACGCCTGCCCCGCGTGCGAGGATTGACCAACCTGGGCAATACAT
        GCTTCTTTAATGCGGTGATGCAGTGCCTCGCCCAGACGCCGTTCCTACTTAGCGTACTGAAAGAACTGTCGGAGCCCGGA
        GAAGAATTCATCTTACCTGGCGGAACGTTCACCATAAAGGACAAAGGTGACATTGAGCTGCCGATGATCAAGGGTACCCT
        GTCCTCTTGGGGTGGACTCACGGCCGCGTTAGCCAATGCCCTTGAGGAACTGCAGGCTGGCGGTAGTGTATTTACGCCCA
        GAAAACTCTTCGACAGGCTGTGCGTAAAGTGTCCTCAGTTTACGGGCGGCGATCAGCATGATGCTCACGAACTGCTGCGC
        CAGCTACTGGAGAGCGTGCGGAACGAGGACCTAAAGCGCTACCAGCGTGTAATTCTGCAGAACCTCGGCTACAAGGATCA
        GGATGTAAATAGTGTGTCAGAGGAGATGCGACAAAAGTGCAAGATCTATGGCAATCAAGCAGGAGACCGAATTCTGCGCC
        CGGAACAGGTATTCCGTGGCTTTCTTGTGTCAACGCTCACCTGCCAGGATTGTCACAATGTTTCCTCGCGGCACGAGTAC
        TTCCTGGACATGTCGCTGCCCGTGGCCGTAGAGAAACCTCAGCCGCCGCAGCGCCGAAAGCCAAGTCCGGAGCTCAGTCT
        TACGTCCAGCAGCTCTAGCGTCACCCCGAGCACTGGCCAGCCGACGATAAACACCAAGTTTACGGATGGTAGTGTCAACT
        TTACAGCCTCATCCCCGTCCTTCTTCCTGCACGCCCATGAGGCGGCATCCCTGGGCCCATCCAAGTCGCAGGTGAAAAAG
        GAGAAGGAGCGACAGCGTAAGGCGAAGCGGGCGGCCAAGAAGCGTCAGAAGTCTAGCCTTAATCTGAACGGAAATGATAG
        CGGAAATGGCAATGAATTGGCCGAGTCCGTAGACCAGGACGATGCCTCATTGGCTTCCCTGGGTGCCGGCGACGGCCAGG
        CCAATGATGGCCTCGAACAGACCAACGGCCAGACCGAGGATTCCACCACCTCCAGCGTGACTACTTCGGAGCACTCCGAC
        GCCGATGTTGAGGACAATCTGGTGGAGGATACAGCCGCGCCGTCCACTAATAATGTGCCGAGCAGTACGGCATCCTTGAC
        AGCTCCCTCCAAGACCTACATGGACAGCAATGGCAATGCCCAGCCGCCGGGGGAGAAGCGCGACGATACGCCGGAGCACA
        TGGACAAGGATTCGCTCGAAGAGGACGAGAATGACTCGGGAATCGCCACCAGTCCAGCACCAACTGCTACCAACAGCAGC
        ACCAGTACCAGTGCCACAGGGAACAATAACTCTGTTGCCGGATCGGGGCTGTCCGGTTCATCGGGCGCTCTGGAGGATCC
        CTTGGCGCCAGCCAGCTTGGTCACTGCCGGACTCTCAGAGAAGGGCGCCTCGGTGATCCGCCAGGTCTCGGTGGGAGCTG
        AGCAGGGCGCATCCAATGGCACAGAAGACGCGGATGGCGAAGCCAAGGCAATCGAGCAGCCAGAGAAGACTCCTAGCCAA
        GCTCAAGCCATGGCTCAGGCCCAGGCCCGTACGAAGCGAGTGCGCACGCAAAGCTACTCGGACTGGAGCACCACGATAGC
        GCCGCGCTACCAGTGCGAGGATGGAGAGTGCTCCGTGCAGTCGTGCCTCAATAATTTCACCGCTGTCGAGCTGATGACGG
        GACAGAACAAGGTGGGATGCGATAGCTGCACGCAGCGCATTAACGGCAGTGATCCGAAGGCCAAGTCGGTGAACACCAAT
        GCCACGAAACAGCTGCTGGTCTCCAGTCCGCCAGCGGTGCTCATACTACACCTGAAGCGTTTTCAGCTGGGACCGCGCTG
        CATCTTCCGCAAGCTGACGCGCCCGGTTAGCTATCCCAATCTGCTGGACATTGCCGCCTTTTGTGGGTCCAAGGTCAAGA
        ATCTGCCGAACATCGATCGCAAGCAGAAGAAGCTGTTGTACGCGCTATATGGCGTAGTGGAGCACTCGGGCGGCATGTAC
        GGTGGCCACTATACGGCGTACGTGAAGGTGCGTCCAAAGGTGGCGCCGGGCGACAAACGCTGGAAGTTCCTGCCGCATGG
        CAGCAAGGCGGAATTGGACCAGGACGATGACCAACTAAAAAAACTGGAGGAGCTGCTTGCCAAGGAGAAGGCGCGCGAGC
        AGCACCTGAAGGTGTTGGACGACAGCGATGACTTTAGCAACTCCAGCAGCAACTCGTCCACCTCCGACGAGAGCCAGACC
        CCAGCCACGCCACTGGAGGAGCAACAGACGCAGCAGGCGCAGCAGCCGCAGCAGCCGCAGCAGCTGGAGGAGGCTGCCAA
        CGTTCGTGCGCCGCCTGGCAAATGGTATTACGTGTCCGACTCGCGTGTCCAGGAGGTCAGCGAGGATACGGCGCTGAAGG
        CGCAGGCCTATCTGCTTTTCTACGAACGCATATACTAGGGATTAGCTCGAGCTTTAAGCGGAACTGAGGATGCGAGGCGT
        ATGGAAGAAAATTTTGGAATCCTATATTTGATACAGACAGAGTGCCGGAGAAAGAGAAGGCAGATACTCACACATGCCAA
        ATGCATTTGGTTTCTCCCACTCAAAATTAATTGTACACTTTCGCTATTTTTATTATTATTATTTTTTTTTTTTGGAACAA
        GCTTTAGTTAGTTAAATGATGCAAAGGAGTAGACACACGCACTCATGTTAAATTGTAGTTCTCAGGAGGTTTGCTATTAT
        GTCCTCGATTTAATTGTACTATTTTTTTAGTCATTAACAAAAAGACACTGAAGAGAAAATTATGTTTTATTAGCTGTAAG
        TTCTTTTGTTACCAAAATTGCCCATTATGACAGAAAGTTACTTAAACATACTCGAGTTGGGGGTTAAAAAAATGGATCGA
        AAGGAAAAGACAGACCGCAGAATGGATAGCTAAAAACGGATAAGCACAAATGAAATGGAGGCGGTTAACCAAGAGAGAAA
        CTATTTGCAGATGTTCATAAGTTATAATAACGAATAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0070773
        4141
        FBtr0070775
        4066
        FBtr0340461
        4093
        FBtr0340462
        4454
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0070738
        1126
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0070739
        1126
        FBpp0070741
        1126
        FBpp0309403
        1126
        FBpp0309404
        1126
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG4165-RD
        Usp16-45-RD
        Secondary FlyBase IDs
          References (2)