Open Close
General Information
Symbol
Dmel\Usp16-45-RA
Species
D. melanogaster
Annotation Symbol
CG4165-RA
FlyBase ID
FBtr0070773
Feature type
Associated gene
Evidence Rank
Length (nt)
4141
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 59 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CGCGGGAGTTGCGACCCAAATAAGCAACGGTCACACTTGGTCACGTCGTTCACGTTTTCTATTTACGCATATACGAATAA
      AAAAAAGTGCATAAAAGTGCTGTAAAACATATATGTTGTGTGCTTACGTGCAACGCATATCGCAGCGAGTAAATTCAAGA
      GCGCGCCCACAAGGAGGCCAAGGCCAAGCAGCTACCTTGCCATGGTAAAGAAGCGTCAGGCGGACAGTCGCGACCACGAT
      TGCTCAACGGATTCCGGCAATGAGGATCTGCATCATCGAAAAGGACTCGGCTCGCCCGGTCAGTCGGATGGCGCCACCCC
      CACCACCGCCAGCTGCCAGCACATCAAGAAGGCGGTGGACGCGGCCCGACTAAGGCGTCTACTGAAGTCCACGGGTCTAC
      TCTACGAGTGCAGCCAATGTCAGAAGCTGGGCAAGACAGCGGGCAGCGCTGCGGGAGCGGGAGCGAGTGAAGGAGCTGTC
      GGTCCTGGCGGAAATCCGGTCACCTTCGAATTTGACAACACCCTGTGGCTGTGCCTCAAGTGCGGCAGCCAGCTGTGCGG
      GAGGGCACGCCACAAGCACGCCTTAGAACACTACCAGACACCTCATTCGGACTCACATGCCCTGGCCATGAATACGCGCT
      CCTTCGACATCTGGTGCTATGAGTGCGACATGAAGATCTGCTCCAATCTGCGCAAAAACCTGCTTGAGTGCGTGGAGCTG
      GTCAAGAAATTGGCCCAGAAGCCGCCCACTAGCACGGTTACGCCCAGTACGCCAACGATTAGCTACATCGAGGAGAAGCT
      TAAAGCCGCGCTGGAGCATCTCACACCAATAGTGCCAATGACTGGCGGATCATTTGACGACTCCAGCAGTAGAGGGTCTC
      TGGCGGCGGCCGGTGGCGGGGGCGGGGTCGGTTCATCTCGAAATAGGCAGGTGGCCATACCGATGCCACCACCAGAGCCT
      AGCTCCGGACTTTCGACCTCAGACTCGCTGACCAGTGTGCCGGGTATGGCAAAGAGAATTGACCAGTACTCGGCCACCAC
      CAATGGCAACACTGGGAACAAACGACTCCTGACCCTAGAGACGCCGCGCATCGAAAATGAACGCCTGCCCCGCGTGCGAG
      GATTGACCAACCTGGGCAATACATGCTTCTTTAATGCGGTGATGCAGTGCCTCGCCCAGACGCCGTTCCTACTTAGCGTA
      CTGAAAGAACTGTCGGAGCCCGGAGAAGAATTCATCTTACCTGGCGGAACGTTCACCATAAAGGACAAAGGTGACATTGA
      GCTGCCGATGATCAAGGGTACCCTGTCCTCTTGGGGTGGACTCACGGCCGCGTTAGCCAATGCCCTTGAGGAACTGCAGG
      CTGGCGGTAGTGTATTTACGCCCAGAAAACTCTTCGACAGGCTGTGCGTAAAGTGTCCTCAGTTTACGGGCGGCGATCAG
      CATGATGCTCACGAACTGCTGCGCCAGCTACTGGAGAGCGTGCGGAACGAGGACCTAAAGCGCTACCAGCGTGTAATTCT
      GCAGAACCTCGGCTACAAGGATCAGGATGTAAATAGTGTGTCAGAGGAGATGCGACAAAAGTGCAAGATCTATGGCAATC
      AAGCAGGAGACCGAATTCTGCGCCCGGAACAGGTATTCCGTGGCTTTCTTGTGTCAACGCTCACCTGCCAGGATTGTCAC
      AATGTTTCCTCGCGGCACGAGTACTTCCTGGACATGTCGCTGCCCGTGGCCGTAGAGAAACCTCAGCCGCCGCAGCGCCG
      AAAGCCAAGTCCGGAGCTCAGTCTTACGTCCAGCAGCTCTAGCGTCACCCCGAGCACTGGCCAGCCGACGATAAACACCA
      AGTTTACGGATGGTAGTGTCAACTTTACAGCCTCATCCCCGTCCTTCTTCCTGCACGCCCATGAGGCGGCATCCCTGGGC
      CCATCCAAGTCGCAGGTGAAAAAGGAGAAGGAGCGACAGCGTAAGGCGAAGCGGGCGGCCAAGAAGCGTCAGAAGTCTAG
      CCTTAATCTGAACGGAAATGATAGCGGAAATGGCAATGAATTGGCCGAGTCCGTAGACCAGGACGATGCCTCATTGGCTT
      CCCTGGGTGCCGGCGACGGCCAGGCCAATGATGGCCTCGAACAGACCAACGGCCAGACCGAGGATTCCACCACCTCCAGC
      GTGACTACTTCGGAGCACTCCGACGCCGATGTTGAGGACAATCTGGTGGAGGATACAGCCGCGCCGTCCACTAATAATGT
      GCCGAGCAGTACGGCATCCTTGACAGCTCCCTCCAAGACCTACATGGACAGCAATGGCAATGCCCAGCCGCCGGGGGAGA
      AGCGCGACGATACGCCGGAGCACATGGACAAGGATTCGCTCGAAGAGGACGAGAATGACTCGGGAATCGCCACCAGTCCA
      GCACCAACTGCTACCAACAGCAGCACCAGTACCAGTGCCACAGGGAACAATAACTCTGTTGCCGGATCGGGGCTGTCCGG
      TTCATCGGGCGCTCTGGAGGATCCCTTGGCGCCAGCCAGCTTGGTCACTGCCGGACTCTCAGAGAAGGGCGCCTCGGTGA
      TCCGCCAGGTCTCGGTGGGAGCTGAGCAGGGCGCATCCAATGGCACAGAAGACGCGGATGGCGAAGCCAAGGCAATCGAG
      CAGCCAGAGAAGACTCCTAGCCAAGCTCAAGCCATGGCTCAGGCCCAGGCCCGTACGAAGCGAGTGCGCACGCAAAGCTA
      CTCGGACTGGAGCACCACGATAGCGCCGCGCTACCAGTGCGAGGATGGAGAGTGCTCCGTGCAGTCGTGCCTCAATAATT
      TCACCGCTGTCGAGCTGATGACGGGACAGAACAAGGTGGGATGCGATAGCTGCACGCAGCGCATTAACGGCAGTGATCCG
      AAGGCCAAGTCGGTGAACACCAATGCCACGAAACAGCTGCTGGTCTCCAGTCCGCCAGCGGTGCTCATACTACACCTGAA
      GCGTTTTCAGCTGGGACCGCGCTGCATCTTCCGCAAGCTGACGCGCCCGGTTAGCTATCCCAATCTGCTGGACATTGCCG
      CCTTTTGTGGGTCCAAGGTCAAGAATCTGCCGAACATCGATCGCAAGCAGAAGAAGCTGTTGTACGCGCTATATGGCGTA
      GTGGAGCACTCGGGCGGCATGTACGGTGGCCACTATACGGCGTACGTGAAGGTGCGTCCAAAGGTGGCGCCGGGCGACAA
      ACGCTGGAAGTTCCTGCCGCATGGCAGCAAGGCGGAATTGGACCAGGACGATGACCAACTAAAAAAACTGGAGGAGCTGC
      TTGCCAAGGAGAAGGCGCGCGAGCAGCACCTGAAGGTGTTGGACGACAGCGATGACTTTAGCAACTCCAGCAGCAACTCG
      TCCACCTCCGACGAGAGCCAGACCCCAGCCACGCCACTGGAGGAGCAACAGACGCAGCAGGCGCAGCAGCCGCAGCAGCC
      GCAGCAGCTGGAGGAGGCTGCCAACGTTCGTGCGCCGCCTGGCAAATGGTATTACGTGTCCGACTCGCGTGTCCAGGAGG
      TCAGCGAGGATACGGCGCTGAAGGCGCAGGCCTATCTGCTTTTCTACGAACGCATATACTAGGGATTAGCTCGAGCTTTA
      AGCGGAACTGAGGATGCGAGGCGTATGGAAGAAAATTTTGGAATCCTATATTTGATACAGACAGAGTGCCGGAGAAAGAG
      AAGGCAGATACTCACACATGCCAAATGCATTTGGTTTCTCCCACTCAAAATTAATTGTACACTTTCGCTATTTTTATTAT
      TATTATTTTTTTTTTTTGGAACAAGCTTTAGTTAGTTAAATGATGCAAAGGAGTAGACACACGCACTCATGTTAAATTGT
      AGTTCTCAGGAGGTTTGCTATTATGTCCTCGATTTAATTGTACTATTTTTTTAGTCATTAACAAAAAGACACTGAAGAGA
      AAATTATGTTTTATTAGCTGTAAGTTCTTTTGTTACCAAAATTGCCCATTATGACAGAAAGTTACTTAAACATACTCGAG
      TTGGGGGTTAAAAAAATGGATCGAAAGGAAAAGACAGACCGCAGAATGGATAGCTAAAAACGGATAAGCACAAATGAAAT
      GGAGGCGGTTAACCAAGAGAGAAACTATTTGCAGATGTTCATAAGTTATAATAACGAATAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0070775
      4066
      FBtr0070772
      4117
      FBtr0340461
      4093
      FBtr0340462
      4454
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0070739
      1126
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0070741
      1126
      FBpp0070738
      1126
      FBpp0309403
      1126
      FBpp0309404
      1126
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG4165-RA
      Usp16-45-RA
      Secondary FlyBase IDs
        References (2)