Open Close
General Information
Symbol
Dmel\Shmt-RA
Species
D. melanogaster
Annotation Symbol
CG3011-RA
FlyBase ID
FBtr0070827
Feature type
Associated gene
Evidence Rank
Length (nt)
2001
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 112 )
Sequence
TGTTAGCCTGGTAAATGTTGTTTACCAACGTAACGCGTGTTTTCGCTTCGTTGTATTTTCGGTGTCGAATATTTTGGATG
CTGGCCAAGAGATAGCGCAGCGATCGGGTCGGAACTCTTGGGCGGACTTATCACTGGGTCGGTCAGGGGTCACGGGTTAT
CGTTATCGCTTATCAGCCAGCGGCGGCGTCATCTCAGCGCCGGCGACTCTTCTCACTTTGCGGCAGTTCCGATTCGAACG
CAGCCGTTTACAAAGACATGCAGCGGGCGCGCTCTACACTGACACAAAAGCTTCGGTTTTGCCTTAGTCGGGACCTGAAC
ACCAAAGTTGGCAACCCGGTTAACTTCGAGACTGGAAAGCTTAGCGGAGCTTTAACTCGCATCGCCGCCAAAAAACAACC
ATCACCAACGCCATTCTTACCGGCGATCAGACGATATTCGGACTCCAAGCAGAGCACTTTGAAGAATATGGCCGATCAGA
AACTGCTGCAAACCCCGCTGGCACAGGGCGATCCGGAGCTGGCCGAGCTGATCAAGAAGGAGAAGGAGCGCCAGCGCGAA
GGACTCGAGATGATCGCCAGTGAGAACTTCACCTCGGTGGCGGTTCTCGAGAGCCTGAGCTCCTGCCTGACCAACAAGTA
CTCCGAGGGATATCCCGGCAAGAGGTACTACGGTGGCAACGAGTACATCGACCGCATAGAGCTGCTCGCCCAGCAACGCG
GACGCGAGCTGTTCAACCTGGACGATGAGAAGTGGGGCGTTAATGTGCAGCCTTATTCCGGATCCCCGGCCAATCTGGCT
GTCTACACGGGCGTCTGCCGGCCCCACGATCGCATCATGGGCCTGGATCTGCCCGATGGCGGTCACTTGACGCACGGTTT
CTTCACGCCCACCAAGAAGATATCGGCCACATCGATCTTCTTCGAGAGCATGCCGTACAAAGTGAACCCGGAGACGGGCA
TCATCGATTACGATAAGTTGGCGGAGGCGGCGAAGAATTTCCGGCCGCAGATCATCATTGCTGGCATATCGTGCTACTCC
CGTCTGCTGGACTATGCGCGTTTCCGACAGATTTGCGATGATGTGGGCGCCTACCTGATGGCCGACATGGCCCATGTGGC
GGGCATTGTGGCCGCGGGATTGATACCATCGCCGTTCGAATGGGCCGACATTGTGACCACCACCACGCACAAGACACTGC
GAGGTCCGCGCGCCGGCGTGATCTTCTTCCGCAAGGGCGTGCGCAGCACCAAGGCCAATGGAGACAAGGTACTCTACGAT
CTGGAGGAGCGCATCAACCAGGCGGTGTTTCCATCACTCCAGGGTGGTCCGCACAACAACGCCGTGGCTGGCATTGCCAC
CGCCTTCAAGCAGGCCAAGAGTCCCGAATTCAAGGCCTACCAGACGCAGGTGCTCAAGAATGCCAAGGCCCTGTGCGATG
GCCTCATTTCGCGAGGCTATCAGGTGGCCACCGGCGGCACCGACGTCCATTTGGTGCTGGTCGATGTGCGTAAGGCTGGC
CTGACCGGCGCCAAGGCCGAGTACATCCTCGAGGAGGTGGGCATCGCGTGCAACAAGAACACTGTGCCCGGCGACAAGTC
CGCCATGAATCCCTCCGGCATCCGGCTGGGCACACCGGCCCTGACCACTCGCGGCCTTGCCGAGCAGGACATCGAGCAGG
TGGTGGCCTTCATCGATGCTGCCCTAAAGGTTGGCGTCCAGGCAGCCAAGCTGGCCGGCAGTCCCAAGATAACCGATTAC
CACAAGACGCTGGCCGAGAATGTGGAGCTCAAGGCCCAGGTGGACGAGATCCGCAAGAATGTGGCCCAGTTCAGCAGGAA
ATTCCCGCTGCCCGGCCTGGAGACCCTGTAGGTGCTGCCTGCTTTGTTTGTCCCTTTTTCTTTTGTTCGCCTTACGATTT
ACATCCTCGAAAAGTCCGCTTGTTAATATCATAAGTGGGAATTAGTAGTTAAGCCATTAAACGCATTTCAGTTTACATAC
C
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0290235
2054
FBtr0345317
1592
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0070792
537
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0288674
467
FBpp0311477
467
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (3)
Reported As
Symbol Synonym
CG3011-RA
Shmt-RA
Shmt2-RA
Secondary FlyBase IDs
    References (2)