Open Close
General Information
Symbol
Dmel\Trf4-1-RE
Species
D. melanogaster
Annotation Symbol
CG11265-RE
FlyBase ID
FBtr0071213
Feature type
Associated gene
Evidence Rank
Length (nt)
4400
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 58 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TAAATAATACTAATTGTTTATAATAATCACAATGTTTTTAACGAATTTAGTTGGTGATGCGTCCTGTCAGTTGAGTAGGT
      GGGAATAGCATGGACTTTCCCCAAATAACAAATGCTAAGTTGGGTTTTTTTAAAATTGATTTAATACATTTTTTTTATGT
      TACAGTTAAATTTGAAACTATATTTAACAAGCAATTTGGATGTCATCGATATTTTGTAATAGGACCATTCACTTAGCGGA
      GTCATCAACCTTGGCGAATCTAGCGAGCACATCCACCTCTCGCTTATCAGGTCTATCGATAACATCGCTCATCAATCGAT
      TCGTGAACCAGCTCTATCGCGAAACGGTCGCGTGTTCGCACGCAAATTGCAATATAAATCCACAGAAATTGACAGGGAAC
      GTTGCTAAAGGGCGAAAAACAATCGTGCCGCGATTGAGGCCTGCGATCTGCACAGGAAATGCACAATTGCGAAGCGCAAT
      TTGATAAATTCGCACTTGAATGCTGACAGCATTCAAAGAGGTTTAGTCCCGGCAGCGACTTTAATTAATTTTTCCCTGTG
      GAGCACAAAGATCACATCGGATCTATATAGAGTCACGTCTATATATTCAGACCACCAGGACGCAGAGGATAGAGGTGAAA
      GGACGAAGCGAAGGAGAGACGCGCGCCCCCCTCGTTTCCCGCCCAGCCAACAGCCGTGTGAACCCGTCTTGAATGGATCC
      ATTTGTTGGCTGGTTTCAGAAGGAACAGGAGGGACCATCGCTGTGCACATGGTTAAAGATTTGGGAGACGAATGCCCAAG
      AGATGGGCGCATTGCTTAATCAACAGCTACAGCAGGCGACGACGATCAACGGGAGCACGAGCAGCAGCAGCAGCAGCAGC
      AATAGTGGTAACAACAACAACAACAACAACAATAACATCATCAATAACACTATCACCAACACGACCAATAACACTGGTAA
      CAATTCATCGGCCAAACCCTACTTATCGCGACCCTACAGCTCGCTAAATCGGGTGCTCAATTTCCGAGCGGATTCCCTGG
      AGATCCTGCAGCAGCAACAACAACAGCAGCAGCTCAACGGGACCACTCAGCGCAACAGCACCAACATCAATACCACAAGC
      GGCGGCAGCACTAGCTCGTCGGCAGATTCCACCACGAATCGGGACAATAACTCACCCGCCAATAGCAGTTCAACCAACGG
      ACCCGGAGCAGGAACGGGAACGTCAACAGGAGCAGGAGGTACCGGTACAAATAGTCCGGCGACGACAGCGTCAAGCACAG
      CTGCGACCACGACTGGTCCAGCCACTAGTATGAGCGACACCAGCAACAACCCGCCACAATCAACGACCACGCCCGCCAGC
      CGCACGAACAGCATCTACTACAATCCATCGCGGAAGAAACGACCGGAGAACAAGGCTGGCGGAGCCCACTACTATATGAA
      CAACCATATGGAGATGATCGCCAAGTACAAGGGCGAACCGTGGCGCAAGCCGGACTATCCGTATGGCGAGGGCGTTATCG
      GGCTGCACGAGGAGATCGAGCATTTCTATCAGTACGTCCTGCCCACGCCCTGCGAACACGCCATCCGCAACGAGGTGGTC
      AAGCGTATCGAGGCCGTTGTCCATTCCATCTGGCCACAGGCAGTAGTCGAGATCTTTGGCTCCTTTCGCACTGGCCTCTT
      TTTGCCCACCTCCGACATAGATCTCGTTGTGTTAGGTTTGTGGGAGAAGCTGCCGCTGAGAACGCTGGAGTTCGAGCTAG
      TGAGCCGTGGTATCGCCGAGGCTTGTACGGTGCGTGTTCTGGACAAGGCATCAGTGCCCATCATCAAGCTGACGGACCGG
      GAAACGCAAGTGAAGGTAGACATATCGTTCAACATGCAGAGTGGTGTTCAGTCGGCGGAGCTGATTAAGAAGTTTAAGCG
      CGACTATCCAGTGCTGGAGAAGCTAGTGCTTGTGCTGAAGCAGTTCTTACTACTTCGCGATCTCAACGAGGTGTTCACGG
      GCGGCATCTCCTCCTACTCGCTGATCCTTATGTGCATCAGCTTCCTGCAGATGCATCCGCGCGGTATCTACCACGATACA
      GCCAATCTGGGGGTGCTTCTCCTCGAGTTCTTCGAACTTTATGGACGTCGCTTCAACTACATGAAGATCGGCATCTCCAT
      AAAGAACGGTGGCCGCTACATGCCCAAGGATGAGCTGCAGCGTGACATGGTCGATGGCCATCGACCCTCGCTCCTGTGCA
      TCGAGGATCCGCTGACGCCAGGCAATGATATCGGTCGAAGCAGCTACGGCGTCTTCCAGGTGCAACAGGCATTCAAGTGC
      GCCTACCGCGTGCTCGCCCTTGCCGTCAGTCCGCTCAACCTTCTCGGCATCGATCCGCGCGTCAACTCGATACTGGGTCG
      AATCATTCACATCACCGACGACGTGATCGATTATCGCGAATGGATCCGCGAGAACTTCGAACATCTGGTGGTGGTGGATC
      GTATCTCGCCGCTGCCCACTGCCGCTCCCACTGCGTACGCCACCGCCAATGGGGCGCCAAAATATGTGATTATGCCCTCG
      GGCGCCGTTGTCCAGCAGCTGTACCATCATCCGGTGCAGGTGCCCACCGCTCACGGGCACAGCCATGCGCACAGCCACAG
      TCACGGGCACGCGCATCCTGGCGCCCATCTGTGCCAGCCGTATGTGACCGGGACCACTGTATCTGCTGTAACGACGACTA
      CAACGATGGCGGTGGTGACCGTGGGCGTGTCAGCCGGCGGAGTCCAACAGCAGCAACAGCAACAGAATGCGACGGCCCAT
      ACCCACTCGCAACAGCAGACACAGAACCAATCGCAGTCGCGCCATAGACGCGGCAGCACCTCGTCGGGCGATGACTCCGA
      GGATAGCAAGGACGGCGATGTTGTCGAGACGACGTCGAGTGCTCAGGAGGTCGTTGACATCGCGCTATCGACGCCAAATG
      GCCTGGCCAACATGTCCATGCCCATGCCAGTGCATGCTGTCGGAATGCCTGCGTCGAACAGTTGGAGCGGTAATGGCAAT
      GGAAACGGAAACAGCAGCTCATCCACGGGCTCGTCGCCGGAAATCGCACACATCGCTGCCCAGGAAATGGACCCCGAGCT
      TGAGGATCAACAGCAACAACAGCAGCACCAAGAGACTTCTGGAGGTAATGGCTTCATCCGACCGGGTGACGTCGGCACCG
      GTTCCAACAGGGGAGGCGGTGACGGCAGTGGCGGCCGCAATTACAACCAGCGGAACAACCACAACTCCAGCGGCTACTAC
      CACCAGCAGTACTACGTGCCACCGCCGATGCAACAGCAGCTGAGCAAGTCCAACTCCTCCTCCAACTATCACCAGCAACA
      CCATCACAGCCACAGCCATGGCAATCATAGTCACCGACAACAGCATCACCACCAGCAGCAGCACCACCACCAGCAGCGGC
      CGCAGCATCTGCGTGTGGGCGGCGGCAATCGATACCAGAAATCGTTGGGCGGATCGCCCATCATCAGTGCTGGCAATGCG
      TCGAACAGCAGCAGTAATTGCAGCAACAGCAGCAGCAGCAGCGGCAGCAACAACAGCCGACTGCCGCCGCTAAGGGGCAC
      GCTGGTCAACTCATCGTCAGCAATATCAATCATTTCCATATCCTCAGAATCATCCATTGCTAGCAGCAGCTCCAGTTCGT
      CAAGATCCGGTCAGGATCAGCAGCGTGACGAGCGATAGGAATAGGATGTAGGAAGATATTGTGTATGTCTATGACACAGA
      GAGAAAGAGAGTGCGACACAGAGGGACAGAGAATGAGAGAGAAAGAGATAGTTACGGTGTTAGCAATATTTATGGGTTAC
      ATTTCTTTCTCAGGTTAATTGTAAACTACGCTGCATTTTTCTAATAAATATCATTGACCCCCCCGCCCCCCCGCCTCTAC
      CTAATCCGAAAGCATCTCCTCAACCAATGTAACTGCGATCAGATTTTCTTTTACACTGCTGTCTTGCTTAAATTGGGAGA
      GCGACGCAGACCTACTAAGCCTAGTGTTAGGAACTTTGCCTCTGATCGCGCTAAATGTATTTCAGTTTGTTTCTAAAATA
      AACATGAAAGCAAAGAATATATATATATATATATATATATATTTATATATATAGATATATATTAAATTAAATTAAATTGT
      ACCATAAGCATAACTGTTAGCTCATAAGTAGATTGTAAGGGTTTAAAAGATCGATAAACTGAAGTATGAAATTATGCTAA
      TCTCTTTTCCCATACCCCCCCCCCCCCCTTTTTATCCATCATCATGCGCATTCAAGCTTCTAAAGTATTTTGTAGTTTCT
      GAAATGCTCTCCGTCTAGTGCAATGGTAAACATTTTTGCAAACGTAACTAATTCCCTATCCACCCCATTTCCTGCCATAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0071212
      4205
      FBtr0112963
      3981
      FBtr0112964
      6507
      FBtr0331723
      3975
      FBtr0331724
      4238
      FBtr0331725
      6812
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0071159
      1001
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0071158
      1001
      FBpp0111876
      802
      FBpp0111877
      802
      FBpp0304112
      1001
      FBpp0304113
      1001
      FBpp0304114
      1001
      Comments

      Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG11265-RE
      Trf4-1-RE
      Secondary FlyBase IDs
        References (2)