Open Close
General Information
Symbol
Dmel\Egfr-RB
Species
D. melanogaster
Annotation Symbol
CG10079-RB
FlyBase ID
FBtr0071654
Feature type
Associated gene
Evidence Rank
Length (nt)
6124
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 43 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AGTCTCGAATACAACTTGTTGCTGCGCGGACGCGAATCGCTCAGTACGGACGTCTTGAGCTCGAATCCTCGGCCATATCT
      GTGCTCTCGATCGCAGCGTTTGCTAATTCGAAGATCGTGCTAATCGAAGTACCGAGAAATCACAGTTCGCAAAACGACCA
      AAACCAAAGCCAAAAACGGGGTGTAAGCCAAGTGCCTTTGGCCTATACTATACTACTAAGCGTATTTTTGTGAATACCCT
      GCTAATTGGCAGCCGCGGCTGTGGCGGTTGTGGCTCAGTTCGAATGATGGCCAAGTGTGTGTGTTTTGTGCAAGTTAACC
      GCTGCGGGGGCAACACAACAATTGCTTAGGGCAATCAATTAAAGCTGAAAGCTAAGAGCTGCGCCTGCGCACGCCTCTCT
      AACCTCAAAAATCGTTGGCGAACTCAAAAAAGAAGCTGAAAAATACATCTGAAAAATAACAAAAATTTTATTTTTTACAT
      ACACTCATATATATATATATATATATATGAAAGCCTTCGGACGACTCTTGTGGCTCGTAATGTGAAACTGGTTCCTACAC
      TCACGCACACACTCACTCACTGGCGCGTTCAAAAGACCCACTCGAAAACACACACTCACTCTCACGCGCATACACAGTGA
      AATGTAAACACCAATACAGTGGCAAATTGCAACGACAACAGCTTAAATTCAAAACAACAACAACAACAACAGCAACCGCA
      GCAAACGCAGTGAAAGAGTCGAAATCAAATTTATGAAAAGCTGTATTTTTGGCACGCAAAGCTGAGTGAGCAAAAAGCCG
      AAAGTAAACCGCAAGTTCAAGAAAAAGAAACGAATAAAAAATAACCCCTATGACGTCAGGGGTTATAGCTTGGAAGAGGG
      CTTGATTCATCCCACCAGTAACGCCCACAAAAAGCACCAACCACCAAACCACCCACCGCCCCGCAACAATGCTGCTGCGA
      CGGCGCAACGGCCCCTGCCCCTTCCCCCTGCTGCTCCTGCTCCTGGCCCACTGCATTTGCATTTGGCCCGCGTCGGCGGC
      CCGCGATCGCTACGCCCGCCAGAACAATCGCCAGCGCCATCAGGATATAGATCGCGATCGGGATCGAGATCGATTCCTAT
      ACCGCAGCAGTTCGGCCCAAAATCGACAGAGGGGCGGGGCCAACTTCGCCCTGGGACTGGGAGCCAACGGAGTCACCATT
      CCCACCAGTCTGGAGGATAAGAACAAGAACGAGTTCGTCAAGGGGAAAATCTGCATCGGCACTAAATCTCGGCTCTCCGT
      GCCCTCCAACAAGGAACATCATTACCGGAACCTCAGAGATCGGTACACGAACTGTACGTATGTGGATGGCAACCTGGAGC
      TGACCTGGCTGCCCAACGAGAATTTGGACCTCAGCTTCCTGGACAACATACGGGAGGTCACCGGCTATATTCTGATCAGT
      CATGTGGACGTTAAGAAAGTGGTATTTCCCAAACTACAAATCATTCGCGGACGCACGCTGTTCAGCTTATCCGTGGAGGA
      GGAGAAGTATGCCTTGTTCGTCACTTATTCCAAAATGTACACGCTGGAGATTCCCGATCTACGCGATGTCTTAAATGGCC
      AAGTGGGCTTCCACAACAACTACAATCTCTGCCACATGCGAACGATCCAGTGGTCGGAGATTGTATCCAACGGCACGGAT
      GCATACTACAACTACGACTTTACTGCTCCGGAGCGCGAGTGTCCCAAGTGCCACGAGAGCTGCACGCACGGATGTTGGGG
      CGAGGGTCCCAAGAATTGCCAGAAGTTCAGCAAGCTCACCTGCTCGCCACAGTGTGCCGGAGGTCGTTGCTATGGACCAA
      AGCCGCGGGAGTGTTGTCACCTCTTCTGCGCCGGAGGATGCACTGGTCCCACGCAAAAGGATTGCATCGCCTGCAAGAAC
      TTCTTCGACGAGGGCGTATGCAAGGAGGAATGCCCGCCCATGCGCAAGTACAATCCCACCACCTATGTTCTTGAAACGAA
      TCCTGAGGGAAAGTATGCCTATGGTGCCACCTGCGTCAAGGAGTGTCCCGGTCATCTGTTGCGTGATAATGGCGCCTGCG
      TGCGCAGCTGTCCCCAGGACAAGATGGACAAGGGGGGCGAGTGTGTGCCCTGCAATGGACCGTGCCCCAAAACCTGCCCG
      GGCGTTACTGTCCTGCATGCCGGCAACATTGACTCGTTCCGGAATTGTACGGTGATCGATGGCAACATTCGCATTTTGGA
      TCAGACCTTCTCGGGCTTCCAGGATGTCTATGCCAACTACACGATGGGACCACGATACATACCGCTGGATCCCGAGCGAC
      TGGAGGTGTTCTCCACGGTGAAGGAGATCACCGGGTATCTGAATATCGAGGGAACCCACCCGCAGTTCCGGAATCTGTCG
      TACTTCCGCAATCTGGAAACAATTCATGGCCGCCAGCTGATGGAGAGCATGTTTGCCGCTTTGGCGATCGTTAAGTCATC
      CCTGTACAGCCTGGAGATGCGCAATCTGAAGCAGATTAGTTCCGGCAGTGTGGTCATCCAGCATAATAGAGACCTCTGCT
      ACGTAAGCAATATCCGTTGGCCGGCCATTCAGAAGGAGCCCGAACAGAAGGTGTGGGTCAACGAGAATCTCAGGGCGGAT
      CTATGCGAGAAAAATGGAACCATTTGCTCGGATCAGTGCAACGAGGACGGCTGCTGGGGAGCTGGCACGGATCAGTGCCT
      TACCTGCAAGAACTTCAATTTCAATGGCACCTGCATCGCCGACTGTGGTTATATATCCAATGCCTACAAGTTTGACAATA
      GAACGTGCAAGATATGCCATCCAGAGTGCCGGACTTGCAATGGAGCTGGAGCAGATCACTGCCAGGAGTGCGTCCATGTG
      AGGGACGGTCAGCACTGTGTGTCCGAGTGCCCGAAGAACAAGTACAACGATCGTGGTGTCTGCCGAGAGTGCCACGCCAC
      CTGCGATGGATGCACTGGGCCCAAGGACACCATCGGCATTGGAGCGTGTACAACGTGCAATTTGGCCATTATCAACAATG
      ACGCCACAGTAAAACGCTGCCTGCTGAAGGACGACAAGTGCCCCGATGGGTACTTCTGGGAGTATGTGCATCCACAAGAG
      CAGGGATCGCTAAAGCCATTGGCCGGCAGAGCAGTTTGCCGAAAGTGCCATCCCCTTTGCGAGCTGTGCACCAACTACGG
      ATACCATGAACAGGTGTGCTCCAAGTGCACCCACTACAAGCGACGAGAGCAGTGCGAGACCGAGTGTCCGGCCGATCACT
      ACACGGATGAGGAGCAGCGCGAGTGCTTCCAGTGCCACCCAGAATGCAACGGTTGCACTGGTCCGGGTGCCGACGATTGC
      AAGTCTTGTCGCAACTTCAAGTTGTTCGACGCGAATGAGACGGGTCCCTATGTGAACTCCACGATGTTCAATTGCACCTC
      GAAGTGTCCCTTGGAGATGCGACATGTGAACTATCAGTACACGGCCATTGGACCCTACTGTGCAGCTAGTCCGCCGAGGA
      GCAGCAAGATAACTGCCAATCTGGATGTGAACATGATCTTCATTATCACTGGTGCTGTTCTGGTGCCGACGATCTGCATC
      CTCTGCGTGGTCACATACATTTGTCGGCAAAAGCAAAAGGCCAAGAAAGAAACAGTGAAGATGACCATGGCTCTGTCCGG
      CTGTGAGGATTCCGAGCCGCTGCGTCCCTCGAACATTGGAGCCAATCTATGCAAGTTGCGCATTGTCAAGGACGCCGAGT
      TGCGCAAGGGCGGAGTCCTCGGAATGGGAGCCTTTGGACGAGTGTACAAGGGCGTTTGGGTGCCGGAGGGTGAGAACGTC
      AAGATTCCAGTGGCCATTAAGGAGCTGCTCAAGTCCACAGGCGCCGAGTCAAGCGAAGAGTTCCTCCGCGAAGCCTACAT
      CATGGCCTCTGTGGAGCACGTTAATCTGCTGAAGCTCCTGGCCGTCTGCATGTCCTCACAAATGATGCTAATCACGCAAC
      TGATGCCGCTTGGCTGCCTGTTGGACTATGTGCGAAATAACCGGGACAAGATCGGCTCTAAGGCTCTGCTCAACTGGAGC
      ACGCAAATCGCCAAGGGCATGTCGTATCTGGAGGAGAAGCGACTGGTCCACAGAGACTTGGCTGCCCGCAATGTCCTGGT
      GCAGACTCCCTCGCTGGTGAAGATCACCGACTTTGGGCTGGCCAAGTTGCTGAGCAGCGATTCCAATGAGTACAAGGCTG
      CTGGCGGCAAGATGCCCATCAAGTGGTTGGCACTGGAGTGCATTCGCAATCGTGTATTCACCAGCAAGTCCGATGTCTGG
      GCCTTTGGTGTGACAATTTGGGAACTGCTGACCTTTGGCCAGCGTCCACACGAGAACATCCCCGCTAAGGATATTCCCGA
      TCTTATTGAAGTCGGTCTGAAGCTGGAGCAGCCGGAGATTTGTTCGCTGGACATTTACTGCACACTTCTCTCGTGCTGGC
      ACTTGGATGCCGCCATGCGTCCAACCTTCAAGCAGCTGACTACGGTCTTTGCTGAGTTCGCCAGAGATCCGGGTCGCTAT
      CTGGCCATTCCCGGGGATAAGTTCACCCGGCTGCCGGCCTACACGAGTCAGGATGAGAAGGATCTCATCCGAAAATTGGC
      TCCCACCACCGATGGGTCCGAAGCCATTGCGGAACCCGATGACTACCTGCAACCCAAGGCAGCACCTGGTCCTAGTCACA
      GAACCGACTGCACGGATGAGATACCCAAGCTGAACCGCTACTGCAAGGATCCTAGCAACAAGAATTCGAGTACCGGAGAC
      GATGAGACGGATTCGAGTGCCCGGGAAGTGGGCGTGGGTAATCTGCGCCTCGATCTACCAGTCGATGAGGATGATTACCT
      GATGCCCACATGCCAACCGGGGCCCAACAACAACAACAACATAAATAATCCCAATCAAAACAATATGGCAGCTGTGGGCG
      TGGCTGCCGGCTACATGGATCTCATCGGAGTGCCCGTTAGTGTGGACAATCCGGAGTATCTGCTAAACGCGCAGACACTG
      GGTGTTGGGGAGTCGCCGATACCCACCCAGACCATCGGGATACCGGTGATGGGAGTCCCGGGCACCATGGAGGTCAAGGT
      GCCAATGCCAGGCAGTGAGCCAACGAGCTCCGATCACGAGTACTACAATGATACCCAACGGGAGTTGCAGCCACTGCATC
      GAAACCGCAACACGGAGACGAGGGTGTAGGCTCCAGTCGAGTAGGAGCAATTGCCAATGAAGAAGGAGAATCTTGCCAAG
      TGCCTTTGGAAGCCATGCGGATATGCCTTTGCTGGCTGTTATCTTAGATAGGAGCCCGTGCGCCTGTACAGAGCCTAGAA
      CGACCCATAGATTTGTAAATTACTCTCTAGTGTACTTAGCCAGTCCCCCTGCATCTTTGTGTATACTTCTCTATCCTAGC
      CCGTAAACCAGTAGTCAGCAGGGATCGTCGTCGCGGTCCTGCGCTTGTAGAATCCATGTAATTACGAGAACAAAACACCG
      ATAGTGCATTTCTTAGACGCCTCCGCCATGCCAAATTCGAAGAGATCCCGGATCCGGATCGGCTCCGCCGGAGGGCACAC
      ACTAAGCTAAGCCGATGTCCACTTCTCTCGGGCGTCAATTACTTCTTGTACTTGTAGTTAGTAGTAGTCGTCTCTTTTAG
      CGCCTAGTTTCCAACTGTGATATAGTTTGTAGGACTCGACCTAAGGACTTCTAACACGATGAACAAATCGAACGACTCGA
      AACAGTTAAGCAAATGAAAATAGTGACAAAGTACCGATCTTATGCAATTTTAGGCCAAGTTTCAAATCCCATTCGATATA
      TCAAGTTTGACAATCAAATCCCGAGCGTGCCATGCATCGATCGATGCAAATCTCCTAAAGATTTCGAATACCTTGTTGGC
      ACAATAGAGTGTAAGCGAATGCCTAGCCGATATGTTACTGATCAAAGATACATAAGTAATCCACACAAACATATACTTTT
      AATATACAATACATGTACACGTGTAGATTTGCCAAGTTATGCCTACTGAATAAGTTAATTTAATTTAATATAGACTATTT
      ACATGTATGTGGAAAGTATATATACACAAATAAAATTATTTTTC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0071653
      5698
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0071571
      1426
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0071570
      1377
      Comments

      Extended 3' UTR based on RNA-Seq and/or EST data.

      Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG10079-RA
      Secondary FlyBase IDs
        References (2)