Open Close
General Information
Symbol
Dmel\wmd-RA
Species
D. melanogaster
Annotation Symbol
CG3957-RA
FlyBase ID
FBtr0072114
Feature type
Associated gene
Evidence Rank
Length (nt)
1606
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 97 )
Sequence
GATAGGTAGGTACTGTGTGTGCGGACTATCGAGGCTGGAGTCGGCTACCAATCGTCCATCCACAACAACAACGTGTCGCG
TAATTATTTTCCCCTCTTGTTTATAAAATTCAGTGCATCAGATTGTAAATACACTGCACACCCTGCAAAGCCACCGCAGC
ATCTCGAACCTAAGCAACGAACGGGAAAATCATTATCGTACGGGCAGTGAAGCGCAGTTAACCAGGAGCAACAACCAATC
CAAGTACAAAGTAGCCACAAAACGTCAGTTATTCACTAAGTGCACAGTTCGCCAGCGGACATAACGGTCGCTACACTCGG
AGAAAACCACAAGTATTAAGGACCACACAGTCCACCAATCCACTAGCAGCCCACTGCCATGGCCGCCAACAACTTGCGAC
AAATCCCGCTGACCTGCAGTGGCCACACGCGACCCGTGGTCCACCTGGACTTCAGCGACATCTGCGACGCCGGCTACTTT
CTCATCTCGGCCTGCAAAGATGGCAGCCCGATGCTGCGGCACGGCGACACCGGCGACTGGGTGGGCACCTTCGAGGGACA
CAAGGGCGCCGTGTGGAACGCCACGCTGAACCGAAATGCCACCCTGGCCGCCTCCGGAGCGGCCGACTTCACCGGCAAGG
TGTGGAATGCGGTGACCGGGGCCGAGATACACAGCTTCCAGCACAAGCACATCGTGAAGAGCGTGGCCTTCGACAGGGAT
TCCGAGAACATAGTGACTGGCAGCAACGAGAAGCTGGTGCGGGTCTTCAACCTGGAGCAGCCCGAGGCGCAGCCGGAGGA
GTACGCCGGACATACGGGGGCCATCAAGCGGGCGCTCTTCTGCCGCGGCGACAAGTGCATCATCTCGGCGGCCGAGGACA
AGACGGTGCGCCTCTGGGACCGCATGACGGGCATCGAGGTGCAGCGCCTGCAGTTCAACAGCAATCCGAACAGCCTAGAG
ATCTCCAGCGACAACCACATACTGACCATATCGCACGGCTCCTCGATTAGCTTCTGGGAGATCGACACGCTGAAGAAGCT
GAAGGAGGTGAAAGTGCCGACGAACGTGGCGTCGGCCAGTTTGCATCCGGATAAGCATGTGTTTGTTTGTGGCGGCGAGG
ACTTTAAGATGTACAAATTCGACTACATCACAGGAAACGAAATTGAATCTTTCAAGGGACATTTCGGGCCCGTGCACAGC
GTGAAGTTCAGCCCGGATGGCGAACTCTATGCCAGCGGCTCCGAGGACGGCACTCTCCGGCTGTGGCAGACCACCGTGGG
CAAGACCTACGGCTTGTGGAAGTGCACGGAGCCCGCGGACCTGGGCAATTCCATCAGCTCGCCGCGCGAGGTGCAGGCAA
ACTGATGTTGGCGCAGCAGGAGTCGCTGTTACACAGCCCACGCTGCACCGGCGACGCAACGAAAGGGCATGTGATTCGGA
GCTACGGCTGAGATCCGATTATCAGAACAAGAACAACTCGTAGTGCGGGCTACAATAACGATTCTTCATATTCCAACGCT
GAACTCTCTCATTGGCATTAAATGATAATCACAACACACAAAACTACATTGTGAAATGCAATAGAAATAAATAACTTAAG
TGTCGC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0113112
1661
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0072023
328
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0112025
328
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG3957-RA
wmd-RA
Secondary FlyBase IDs
    References (2)