Open Close
General Information
Symbol
Dmel\SERCA-RE
Species
D. melanogaster
Annotation Symbol
CG3725-RE
FlyBase ID
FBtr0072212
Feature type
Associated gene
Evidence Rank
Length (nt)
3310
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 251 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      Sequence
      AGTTGCCGTTGATCGTTATAATAGCGCGATCTTTGTGTCTTGGTCTTCCGACTGAAATAAATTATTATATAATAACGGAA
      TTTTTGCTAGGAATAATAATTGCCACTGAACGAAGAGGATAACGAATCAAGATGGAAGACGGTCACTCGAAAACCGTCGA
      ACAGTCCCTCAACTTCTTCGGAACGGACCCCGAGCGCGGCTTAACCCTCGACCAGATCAAGGCTAACCAGAAGAAATACG
      GACCCAATGAGTTGCCGACTGAGGAAGGAAAGAGCATCTGGCAGCTGGTCTTGGAGCAGTTCGACGATCTGCTGGTGAAG
      ATTCTGCTGTTGGCAGCCATCATCTCATTTGTTCTCGCCCTGTTTGAGGAACACGAGGAAACGTTCACTGCATTTGTAGA
      GCCCCTAGTTATTTTACTTATCCTGATAGCCAACGCCGTGGTGGGAGTATGGCAGGAGCGTAACGCCGAGTCGGCCATTG
      AGGCCCTCAAGGAGTACGAGCCTGAGATGGGCAAGGTGGTGCGCCAGGACAAGTCCGGCATCCAGAAGGTGCGCGCGAAA
      GAGATCGTGCCCGGTGACCTGGTTGAGGTGTCTGTCGGTGACAAGATCCCTGCCGATATCCGTATCACCCACATCTACTC
      GACCACCCTTAGGATCGATCAGTCCATCCTCACCGGTGAGTCGGTCTCCGTCATCAAGCACACCGATGCCATCCCCGATC
      CCCGCGCCGTCAACCAGGACAAGAAGAACATCCTGTTCTCCGGCACCAACGTCGCAGCCGGCAAGGCCCGTGGCGTCGTC
      ATCGGCACTGGCCTGAGCACCGCCATCGGCAAGATCCGTACTGAGATGTCCGAGACCGAGGAGATCAAGACCCCCCTGCA
      GCAGAAACTGGACGAGTTCGGTGAGCAGCTGTCCAAGGTCATTTCCGTCATTTGCGTTGCCGTGTGGGCCATCAACATCG
      GCCACTTCAACGACCCCGCTCACGGAGGCTCCTGGATCAAGGGTGCCATCTACTACTTCAAGATCGCCGTCGCTCTGGCT
      GTGGCTGCCATCCCCGAGGGTCTGCCCGCCGTCATCACCACCTGTCTGGCTCTGGGCACCCGCCGCATGGCCAAGAAGAA
      TGCCATCGTCCGCTCCCTGCCCTCCGTGGAGACCCTGGGCTGCACATCTGTCATCTGCTCTGATAAGACCGGCACACTCA
      CCACCAACCAAATGTCCGTTTCCCGCATGTTCATCTTCGACAAGGTTGAAGGCAACGACAGCAGCTTCCTCGAATTCGAG
      ATGACCGGCTCCACCTACGAGCCCATCGGCGAGGTCTTCCTCAACGGTCAGCGCATCAAGGCTGCTGACTACGATACCCT
      GCAGGAACTGTCCACCATCTGCATCATGTGCAACGACTCCGCCATTGATTACAATGAGTTCAAGCAGGCCTTCGAGAAGG
      TCGGCGAAGCCACTGAGACCGCCCTGATTGTGCTGGCTGAGAAACTGAACAGCTTCAGCGTGAACAAGTCTGGCCTGGAC
      CGCCGCTCGGCTGCCATCGCCTGCCGCGGTGAGATCGAAACCAAGTGGAAGAAGGAATTCACCCTGGAGTTCTCTCGCGA
      TCGTAAATCCATGTCCTCGTACTGCACCCCCCTGAAGGCTTCCCGCCTGGGCACTGGCCCCAAGTTGTTCGTGAAGGGCG
      CCCCCGAGGGTGTTCTAGAGCGTTGCACACACGCCCGCGTTGGCACCACCAAGGTTCCTCTGACCTCGGCCCTGAAGGCC
      AAGATCCTCGCCCTGACCGGCCAGTACGGTACTGGACGCGACACCCTTCGCTGCCTGGCTCTGGCCGTTGCCGATAGCCC
      CATGAAGCCCGACGAGATGGATCTGGGCGACTCCACCAAGTTCTACCAGTATGAGGTTAACCTGACCTTCGTCGGTGTTG
      TGGGCATGTTGGATCCCCCCCGTAAGGAAGTTTTCGATTCCATTGTCCGCTGCCGTGCCGCCGGTATTCGTGTTATTGTG
      ATCACCGGCGACAACAAGGCCACTGCCGAGGCTATCTGCCGCAGAATCGGTGTATTCGCCGAGGATGAGGACACCACTGG
      CAAGTCCTACTCGGGTCGTGAATTCGACGACCTTTCCCCCACCGAACAAAAGGCTGCCGTCGCCCGCTCCCGCCTCTTCT
      CCCGCGTGGAGCCCCAGCACAAGTCCAAGATTGTTGAGTTCCTGCAGAGCATGAACGAAATCTCCGCTATGACTGGTGAT
      GGTGTGAACGACGCCCCCGCCCTGAAGAAGGCTGAGATCGGTATTGCCATGGGCTCTGGTACCGCCGTCGCCAAGTCTGC
      CGCCGAAATGGTGCTGGCTGACGACAACTTCTCCTCCATCGTGTCTGCCGTTGAAGAAGGTCGCGCTATCTACAACAACA
      TGAAACAGTTCATCCGCTACCTCATCTCTTCGAACATTGGTGAGGTCGTCTCCATCTTCCTTACTGCTGCCCTTGGCCTG
      CCCGAGGCTCTGATTCCCGTCCAGCTGCTCTGGGTTAACTTGGTTACTGATGGTCTCCCAGCCACCGCTCTGGGCTTCAA
      CCCCCCTGATCTGGATATCATGGAGAAGCCCCCCAGGAAGGCCGATGAGGGTCTCATTTCCGGATGGTTGTTCTTCCGTT
      ACATGGCTATTGGATTCTATGTCGGCGCTGCCACCGTCGGTGCCGCCGCCTGGTGGTTCGTGTTCTCTGATGAGGGACCC
      AAACTGTCCTACTGGCAGCTGACCCACCATCTGTCCTGCTTGGGCGGTGGCGACGAGTTCAAGGGCGTTGACTGCAAGAT
      CTTCAGCGACCCCCATGCGATGACCATGGCTCTGTCCGTGCTGGTGACAATCGAAATGTTGAACGCAATGAACAGCTTGT
      CCGAGAACCAGTCGCTGATTACCATGCCCCCATGGTGCAACCTGTGGCTGATTGGATCAATGGCACTCTCCTTCACTCTT
      CACTTTGTTATTCTTTACGTCGATGTCCTCTCCACCGTCTTCCAAGTGACACCGTTGTCTGCAGAAGAATGGATAACTGT
      GATGAAATTCTCAATTCCTGTAGTTTTATTAGATGAGACATTGAAGTTTGTTGCTAGAAAAATCGCAGATGGTGAGAGTC
      CTATATATAAGATGCATGGGATTGTGTTAATGTGGGCTGTCTTCTTTGGCCTGCTGTACGCTATGATGCTTTAAGAATAT
      AATTATAATCCATAAGCCCAACTTCATTATTCTAATTTCTAGTATAAAATGTTACTAAATATAAACAGAAACAAGAACCC
      ACAATTATATACATCTAACGTAACGACTTT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0072215
      3890
      FBtr0072213
      3385
      FBtr0072217
      3395
      FBtr0072214
      3259
      FBtr0072218
      3839
      FBtr0072211
      3269
      FBtr0072216
      5028
      FBtr0343281
      6306
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0072121
      1020
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0072124
      1002
      FBpp0072122
      1020
      FBpp0072126
      1020
      FBpp0072123
      1020
      FBpp0072127
      1020
      FBpp0072120
      1020
      FBpp0072125
      1020
      FBpp0309946
      999
      Comments

      Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (3)
      Reported As
      Symbol Synonym
      CG3725-RE
      Ca-P60A-RE
      SERCA-RE
      Secondary FlyBase IDs
        References (2)