Open Close
General Information
Symbol
Dmel\RpL19-RA
Species
D. melanogaster
Annotation Symbol
CG2746-RA
FlyBase ID
FBtr0072405
Feature type
Associated gene
Evidence Rank
Length (nt)
1361
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 645 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACCCTTCAGAAAATGGTGCTGACTTCCGGCTGTCAAATTTTTCTTTCTTTCCTAGCCACGACGAGGTCGACAGCATGAGT
        TCTCTAAAGCTCCAGAAGAGGCTCGCAGCCTCCGTGCTGCGATGCGGCAAGAAGAAGGTCTGGTTGGATCCCAATGAAAT
        CAACGAGATCGCTAACACAAACTCGCGTCAGAACATTCGCAAGCTTATCAAGGATGGTCTGATCATCAAGAAGCCCGTCG
        TGGTCCACTCCCGTTACCGTGTGCGCAAAAACACCGAGGCCCGCCGCAAGGGACGTCACTGCGGATTCGGAAAGCGTAAG
        GGTACTGCGAACGCCCGCATGCCTACCAAGCTGCTGTGGATGCAGCGCCAGCGCGTTCTGCGCCGCCTGTTGAAGAAGTA
        CCGCGACAGCAAGAAGATTGACAGGCACCTGTACCACGACCTGTACATGAAGTGCAAGGGTAACGTATTCAAGAACAAGC
        GCGTCCTCATGGAGTACATCCACAAGAAGAAGGCTGAGAAGCAGCGCAGCAAGATGCTGGCTGATCAGGCCGAGGCTCGC
        CGACAGAAGGTGCGTGAGGCCCGCAAGCGCCGCGAGGAGCGTATTGCCACCAAGAAGCAGGAGCTCATCGCCCTGCATGC
        TAAGGAGGACGAGATCGCTGCCAAGGCCGCCACCGCGGGTCACTAAGCAGTCCGACCTCGCTAGTCGAGGAACTCCATAT
        TGATAGTACTGTTTATCGTCTGAATAAAACACCTTTAGTTTGGCCGAAATGATTTTGTACAAACGTGAAACTCATGCTTA
        TTTTTTTAATGGCTTTCCCTGGGAGCAGTCGTAAGGGAATTTGGTTGAATGTGACTTGTTAATTCTTATTCCCTTATGTT
        GCATTTCATTGTGAATTCAGATTAAAGACGGTGATTAAATTCAAAATATTCACTTCCCTCGTTTTAATATCCTCAATACC
        CCACAACTTCAAATGCTTAAAAAACTTTAATATATTGGTTCTTGCGACTAGCTTTTTGTGAGAAGTATTTTGGCATTTAA
        TTCGTTAATTATGCCAGGTAATGGATTCATTTTACAAGCAGCGTCAATTATTACTCAGAAGTTTAATTGTTGTATTATCC
        TAATATATTTTACTTTAAGGTTACCCATATTCCAAGCTTAACTGAAAATAAGCTGGCCCTAACTATGTAGGATAACAAGA
        CGTCCCCAAAGCTCTAGAATTCTATATGCATTTGTATTCTTGAATTTAAATCCTATGTATAATTTAAATAAAAAGTCAAA
        TAAATGTATAGTAATAAATAACTGATGAAAAAAGTAAAAAAGGTCATGAAAAACCGCTAATCTTTGATGTAAATGCCAAA
        T
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0072406
        755
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0072312
        203
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0089141
        203
        Comments

        5' UTR based on RNA-Seq data.

        Extended 3' UTR based on RNA-Seq and/or EST data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        RpL19-RA
        Secondary FlyBase IDs
          References (2)