Open Close
General Information
Symbol
Dmel\miple2-RA
Species
D. melanogaster
Annotation Symbol
CG18321-RA
FlyBase ID
FBtr0072506
Feature type
Associated gene
Evidence Rank
Length (nt)
1138
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 35 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TCAGTTTGCCCACAGCTCTGAATGCGAGCGTAACGATCGCAAGCCGCCTGTCTTACAGTGAAGTGCATTTTCTCAAGCCG
      CTTCCTTGATTTGTATTTGGTTGGACAACAGCCTATAACTTGAACCCGTCTTTAATGCCCGTATCTCTGTGAGAGTTTCC
      GAAATAGTTATGAATCTTATACTGGCTTTAACCACGGCTCTGCACCTAGTTTTGGTGGTATTGGCGCACAATCCGCTATC
      AACTCGTGGCGAAAGCCTTTCTGATGGCATACGTCTGGTCATGGAAAAGAGGTCGGGCGATGTGGTACACATTCGTCCAG
      CTCGGGGCACACTGGAGGCCGAAACAGTCGCATCCACAACAAATAGTGACACCCACCGCACCAGGAACAATCGTAAGCCG
      AACAAGCCTCAAGAGCACTCTCAGCAGGTTGGGGCCCACAAGTCGGGATCTAGAAAACTAGTGGTTGCGGAAAATGGCGG
      GGCACTGTCATCACAACTACCACAACCAAATCACAAGCAAGGCCACAAGAACACTGATAAGCAACAACGAGGAGGGGGAT
      CCAAGCAGCAGCGAGGACATAGCCAACATCATGGAGGAAATAGGAAAGGGCCTAAGGCAGCGACTCCAGAGAATGGATCG
      ACTTGCCGATACGCAAAGAGCGCTTGGTCCAATTGTGATCACAAGACCAACATGCGTTCACGAGTCCTGTCCCTAAGGAA
      AGGAGAGCAAAACTGCTTGCCCACGCGGACCATACAAAAGAAGTGCAAGAAAGGCTGCCGCTATGAAAAGGGTGAATGGT
      CTCAATGCGTCGGAGGACAAATAACCAGAGAGGATAAGTTGGAACCAGAGGCAACTGGCGGTAGTGATCAAAACTGCAAT
      CCTGTGCGTACCGTCAGCAAGAAGTGTAAAGCAAATGGCAATTCCAGTGGAGGAAAACAACACGGCCAGAGTCGTCGAAC
      AAAAGAGCAAAAGCAAAAGGATAAGGGAGCCAGTCACATTTCGTCTTGATAATGAAAATTATTTATTTTATACGTATACG
      GAAGCAACATTTTTAATATTAAATAAGCGATTTTTAAATGCTAGCCCGTACGGACTACTTGAACAACAATAAAGAATTGG
      CCTTCTTAGGGCTAAATG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0332836
      1147
      FBtr0332837
      1144
      FBtr0332838
      1031
      FBtr0332839
      1292
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0072406
      279
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0305059
      282
      FBpp0305060
      281
      FBpp0305061
      279
      FBpp0305062
      279
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG18321-RA
      miple2-RA
      Secondary FlyBase IDs
        References (2)