Open Close
General Information
Symbol
Dmel\Ctr9-RA
Species
D. melanogaster
Annotation Symbol
CG2469-RA
FlyBase ID
FBtr0072669
Feature type
Associated gene
Evidence Rank
Length (nt)
3702
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 33 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CAATCGACTCTTGTGCCATCCCTAGCAAGCGTACCGGAATGGAAAAAATATAGTTTTTTGCACATTCTCCGATTTCAGCA
      CATTTTTATAAGTTTTCGGGCCAGTAACCCGTTTTTCACCGCTTAGTTTGTGGGCTCAAGGCCTCCGAAACCATGTCCAA
      CTGCATAGAGATCCCTTTGCAGGACACCGATGAGGTGATCGAGGTGGACCCGGATCAACTGCCCGACTGTCCAGAGGTGT
      TGAGCATTCTCAAGCAGGAGCGGGCGCCCCTGCACGTTTGGGTCAATGTGGCGCTTGCCTACTACAAACAAAAGAAGACG
      GAGGACTTTGTCACGCTGCTGGAGGAGTCGCGCAGCGATGACGCCACCAAGGAGTACCGCGACTCGGACAAGGACCTCAT
      GCGTGCCCTGGACATGCTCGCTGCCCACTATGTCCAGGAGGCGTATCGGGAGAAGTCCAAGGACAAGAAACGAGAGCTCT
      TCATGAAGGCCACCAACTTGTACACCAGTGCCGACAAGATTATCATGTACGACCAGAGCCATCTGTTGGGCAGGGCCTAC
      TTCTGTCTGCTGGAGGGCGACAAGATGGACCAGGCGGATGCCCAGTTCAACTTTGTGCTTAACCAGTCCCCCTCGAATAT
      TCCCTCCCTACTGGGAAAGGCCTGCATCGCGTTCAATCGCAAAGATTACCGTGGAGCGATGGCCTTCTACAAGAAGGCCT
      TGCGTACAAATCCAAACTGTCCTGCGAATGTGAGAATCGGCATGGCCCATTGCTTCCTGAAGATGGGCAATCCCGAGAAG
      GCCAAGCTAGCCTTTGAACGAGCGCTCCAGCTGGATCAGCAGTGTGTGGGCGCTTTGATTGGCCTGGCCGTTCTCAAGCT
      GAATCAACTTGAGCCCGAATCCAACAAACTGGGTGTCCAGATGCTCTCCAAGGCGTACACCATCGACAATGCCAATCCCA
      TGGTGCTCAATCACCTGGCCAATCACTTCTTCTTTAAGAAGGACTATCAGAAAGTCCACCACCTGGCGCTGCACGCCTTC
      CACAACACCGAGAACGAGGCGATGCGAGCCGAGAGCTGTTACCAGCTGGCCAGGAGTTTCCATGCCCAGAGCGACTACGA
      TCAGGCCTTTCAGTACTATTACCAATCCACTCAGATTGCGCCAGCTAACTTCGTGCTGCCCCATTACGGACTAGGCCAGA
      TGTATATTTATCGAGGAGATACAGAAAATGCCGCTCAGTGTTTCGAGAAAGTGCTGAAAATCCAGCCAGGCAACTACGAG
      ACCATGAAGATTCTGGGATCCCTGTACGCACACTCCAATTCGCAAACCAAACGTGACATGGCCAAGACTCACCTCAAGAA
      GGTCACCGAACAATTTCCTGAAGACATTGAAGCCTGGATAGAACTGGCTCAAATCCTGGAGCAGAACGACCTGCAGGCCT
      CGCTCAGTGCTTACGGCACAGCCTCTAGTATTCTTCGGGACAAGGCCAAGTACGAGATACCCGCTGAGATTCAAAACAAC
      GTGGCTTCACTGCACTACCGCCTGGGCAACTTGAAGATGGCAAAGCTCACTTTGGAGTCGGCCCTGAAGCATGCAACCTC
      TGAGATGGACAAGGATGTAAAATACTACGAGTCCATTCAGGTCACCATGAAGTACAATCTGGCCCGTCTGAACGAGGCAA
      TGAGTAGCTACGATGTGGCCGACAAGCTGTACAAGGAGATCCTCAAGGAGCATCCCAACTATATTGACTGCTACTTACGG
      CTGGGTTGCATGGCAAGGGACAAGGGTCTCATTTTCGTGGCTTCCGATTTCTTCAAGGACGCGCTGAACATCAACAACGA
      CAATCCAGATGCGAGATCACTGCTGGGAAATCTCCATTTGGCCAAGATGCAATTCGCTTTGGGACAGAAGAATTTCGAAA
      CGATCCTCAAGAATCCGTCTACTTCCACCGACGCCTACTCACTGATTGCTCTGGGAAACTTTTCGTTGCAAACACTGCAT
      CAGCCGAGTAGAGATAAGGAGAAGGAGAGGAAGCACCAGGAGAAGGCTTTGGCCATATTCAAACAAGTTCTTCGCAATGA
      TCCCCGAAATATTTGGGCCACCAATGGAATCGGTGCCGTGCTGGCACATAAGGGATGCGTGATCGAGGCGCGCGATATCT
      TCGCCCAGGTGCGCGAAGCCACCGCCGACTTTTGCGACGTGTGGCTGAACATTGCGCACGTTTATGTCGAACAGAAGCAG
      TACATCAGCGCTATTCAGATGTATGAGAACTGCATGAAGAAGTTCTACAAGCACAACAACGTCGAGGTAATGCAATATCT
      GGCAAGAGCGTATCTACGAGCCAACAAGCTGGTCGATGCCAAGGCAGTGCTACTTAAGGCCCGTCGAGTTGCTCCCCAGG
      ACACAGTTCTACTCTTCAACATAGCAGTGGTCCTCTCACGTTTGGCCATGGCCATACTCAAGGATGAGAAATCTACTCTG
      GAAATTGTGCTGCAAGCTGTCCATGAACTGGAGCTGGCTCAAAAATACTTCCAATATCTGTCCGTGCACGGGGATAAGAA
      TCGCTTCAACATTGAGGTGGCTGGCATTGAGGCAAGCACCTGCCAAGATCTTCTCTCTCAGGCCCAGTACCATGTGGGCC
      GTGCACGTCGCATTGACGAGGAGGAGCGCTCGTTGCGCCGGAAGCAGGAAGAGGAGCGCGAGGCCTTCAAAATTAAGGTG
      GCGGAGCAGCGCAAGCGGCGCGAGGAGGAGGCAAAGACCTCCAGGGACCAGTTGTTAGCCAAGCGGCAGGAGTACGTGGA
      GAAGACCAAGAACATGCTCATCATTGCGGACGCTCCACCTGAAAAGGAACGCAAGAAGGGTGGTGGGCGAGGTCGTAAAG
      ATGACTACATCTCCGGTACCGAAAGCGATAACGATGGAGCTCGTCGTGAGGGAGAACGTCCCTCGAAGAAGAAGGGCAAG
      GGGGAACGCAAAAAGGGTGGCGGTCGCAAGCGCAAAACGGAGAAGTACGAGAGCGACAGCGAGGAAGAGCCAGGTGCCAG
      TGGCAAGTCGGGAAAGAAGAAGGGCAAGAAGCCGAAGCCGGTTAAAGAGTCCAAGGAGAAGCTTTCTGCCAAGCAGCGCC
      TCAAGGTGCTTTCCAAGGAGACGATCTCCACCAGCGAATCCGAGTCTGACGGCAAGCGCAGCAAGAGCAGAAGTAGAAGC
      AGGAGTCGAAATCGCAGTGGTAGCCGAAGTGGCAGTGCCTCTAGAAGCGGCAGTGATCGCGAGGCTAGCCGCAAGCGCAG
      CAGGAGCAGAAGTGGATCTGGATCTGGGAGTGACAGTGATGAAGCAACTAAGCGGAAGCGCGCCAGGAATCGCATCGAAT
      CTGGCGGGGAATCGGATAGATCTGGGTCCCGTGCTCGCTCCAAGTCGAGTTCCCGTTCAAGATCTCGATCCAAGTCCGGA
      TCTCGATCGAGGTCTCGCTCCAAGTCGGGATCCCGTTCGAGATCGCGCTCAAAGTCCGGTTCCCGCTCGAGATCCCGCTC
      GCCGTCGGGTTCAAGATCCCGCTCTCGCTCTGGCAGCCGATCCAAGTCCGAATCCCGTAGCAGATCAGGGTCCCCGGAAA
      AATAACGCACCTCTCAACCGTGTTAAATCACTTTTGACTATATTTAGAGTTGTCTTCGAGAGCTGCAAAAAGATACTAAT
      AAAAACGAACTAATTGCCACAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0072668
      3770
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0072562
      1150
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0072561
      1150
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG2469-RA
      Ctr9-RA
      Secondary FlyBase IDs
        References (2)