Open Close
General Information
Symbol
Dmel\CG12099-RB
Species
D. melanogaster
Annotation Symbol
CG12099-RB
FlyBase ID
FBtr0072828
Feature type
Associated gene
Evidence Rank
Length (nt)
2935
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 70 )
Sequence
ACTTACAGTCAGCCATTTTCTATCGGGCATCACGGATGCTTTTTTTCCCTGACCAAAGGATATTTGGTTTTTCCATCAAA
ATTTGTTGATTTCGAGACGTCAAATCGAAACCCCGCGATAGCAGAGACCGTGTGTCGGCAGTGTGTGTGCAATTGGCAAG
TGGTAATTGTCGGAAAGATTCGGTTTTGGACCCGCAAAGAGCAGCTAGCGCAGACGTCACACCTTTTTAGGCACCAATAC
GATTACAGCTACTAATACTACGACCCACAGACTAATAGAACAACAAAACAAGTGCTAGAAAAAGAGAAGAAGAATCGAGC
CGCAAGTCCAAGTACTTAAAAAAGTACTTTCGCCTCGAATTTAACTGCACTTACTCGCAAAAGCCGCATTTGATTTTTTG
GAAATATTACGCAAGTACTATTTCTAGTCGTACCCGTTGGATAATCATGGCTCAGTAAACATGAATCCGCAACGAGAATA
CTTTGCTCAGCGCACTCCGTGTGGAGACCTAGGCAAGACGCAATTAGCCGCCCACTGGCAGCTGTCCAGCACCCATACTA
TTACTATTCCCCAAGACAAGTGCACCTCCAGTATCCACAACGATGGACAGCAACAACAGCAGCAACAGCAAGAAGCAGCC
TCAATCCTCTCATCATGGCAAGTCCTCGTCTGCTGAATCGCAAAGGAAGTCCAGTGAGTTACATACCAACAGCAACAAGC
AGCGACACAGCCGTCGAAGGAATCAGGTTCCCACACCGCGCAACGATCAGCAACAACAGCCACAGCAGCCAGCAAAGCTA
CGTCCCAATGTGGACAAGCGTCCGAAGGCTCGCGGGTTTGGAGGCGGTTACGATTTCCCTTCACCCCGTGGCCAGGACGG
GGCTTCAGGCAGCTCCCGACTAGCCTACTCCGCCACCGGCTACTCACGTAGCGGTGACTTTGACCATGAACTGAACTCTG
TGTATACACAGGGCAGCAAGAAGCAGAATCTGAACCATCTGCTTAACTTCCACTGCGTGCCCAGGGAACTGGAGCGAGGA
CATCACCATCAGGCCCAACAGCACCACGGCCTGAGTGGCCGAAAGCAGCGCTACAACAAGGAGCAGTTCCTGCAGGCCAA
CTTTCAGTTCGTCATTAGATCGGGTGCAAAGGCTCAGGTTAATGGCTCGCCGGATGCACTCATCGATTGGAGCTACATCG
AGCAGATCAACATACAGACCACTGAGGAGTTGCAGTGCCCCATCTGCCTGTACCCGCCTGTGGCTGCCAAGCTCACCAGA
TGCGGACACGCCTACTGTTGGCCCTGCTTGCTGCACTACCTCTCGCTGAGCGACAAGACCTGGCGCAAGTGTCCTATCTG
CTATGACGCCATCCACGCGGGAGATCTGAAGAGCTGCACCATCGAACAGCTGAGGGATTTGCAAGTGGGCGAGAAGATTA
CCTTCCAGTTGATGCGGCGTCGCAAGGGCTCCATGTACATTGAAAATCATGTTGCAGGATTGGGCGAAACAATTGAACGT
TTCCCCTTTGTGTCCGCTGGTGAAGAGGCTAAACGCTACTCAAAGTTTCTAATAGCCAAGCGGATGGATGTGGCCGCCAT
CATCGAGAGGGAGCGTAACGAACTGCTAGCCGAATCGGATGTCTCCTGTCCCGAGGATGTGTTCATCCAGCAAGCGCTGG
TGATGCTTCAGGAGCGTGTTGAGAAGTTGGGTGTCGAGAAACCTGATCCGAAAGAGGATGAAGAGGAGACAGCACCTGTA
CTTTGCCTAGAAACCGAGACCAAGATTGATATTGAGAAGTCAGACGATGCCTCCATCTCGTCGGGAGAAGCATCCAGCAG
CCTTAGCTACTCGAGCAACCATAATAAATACTATTATTTCTACCAGTCAAACGACGGACAGAATATTTACTTGCATCCCT
TGAACGTGAAGATGCTTCAGGCTTGCTACGGCACCTTGGACTTGGGTCCGCTACTCATCGAAGCCCAAATCGTGCAGATG
GAACAGCACTCTATGGATGAGGAGCATCGACGCAAGTTCACTTGTCTTGGCCACTTGCCTTTGACTTGTCAGTTTTCGGT
TGTGGAAGTCGAATTGCAGCCGCCAGTGGTCACTGGAGGAATACTCAAGCTCTTTAAGGAGGACATTCTTCATCGTAAGA
AGGAACGACAGCGTCGGGATCGCGAGGAGCGCAAGCGAGAGCAGCACATCAACGAGATAAATGACCGCCAGATGGGCAAA
CTTATTGCCAGTGCAGCTAACCTTGACCTAAGCTCCTCCCATGAGTTTCCCACTTGCGGCTTCGAGGAGGCTTTGCCCGC
TCCCAGTGGCTCTGTGCCCATGAACATCAGCAACCAGGACCCCGGTTCCCGATACTCCAGTGTCACTCTGGGAAGTCCCA
AGCAGGAGATGTGGCCCACTATTGGAAGTAATTCTCCTGGAGGTGGTGGCGCGCCATTGGATGTTCAAGTGGGCGCCTGG
GGCCGTTCAGCTCCACCGCCGCCACGGGCTGTAATGGTCCCAAGAACCAGCGATGAGGACTTTGAGCAGCGATCTGTGGG
CCACTGGGGTCTGGGAGAACTTTTAGTTGGAGCCTTGGACCAGAAAAAGCAAAAGGTAGGAGCAGCAAAATCCAATGGAG
CAGCTCCAGCGGAATCGAAGAAGCAAAAGAAGGCCAAGGGCAAGAAGATGGTTCCCCTGTTCGCCACGGGCATGAACAGA
GCTCCATGAAGAGCTAGATGATGATCGCTTATGAAGTTACAAGATTTATTGTATTTTTGTTTTTATGCGAATATTTCAAC
GTTATTTTAAATAACAAATGCGATTGTTCTATCATTGAAGAGGATTTGGAAAATCATTCAGCTAATCTATAATTTAACCC
AACTTATATTCACAATACACATAAGATAACCAATAAAGGCAGCAAGTAAAATATC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0072829
2827
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0072708
708
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0072709
708
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG12099-RB
Secondary FlyBase IDs
    References (2)