Open Close
General Information
Symbol
Dmel\CG1146-RA
Species
D. melanogaster
Annotation Symbol
CG1146-RA
FlyBase ID
FBtr0072923
Feature type
Associated gene
Evidence Rank
Length (nt)
1903
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 28 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CGTCTGAGTTCGAAAAGAGGAGCCGAAGAGAGGAGAACGACCGCGAGGCGCAACGGAATACAAAAAGCGGCTGAAGAAAC
      AAAAGAATCCGATCCGAAACAGCTCGCAAAAAACTAAATAGCTGCTAAATAAATAAATAAATAAATAAAGCTCGGGCTAT
      CAGATGTCGGGCCAAGATAAAAATACGCACTAATGGAAATATAAATATAAATATTAATGCAAGCGGCAGTCGCAAAGTGC
      AAAACGCAGTGGACACCACTTGAAGAAAGAGTGATGTGATGTCATAATAAAACTTTGCCCTTATCGACAATATAAAAAAA
      AGTGAAAAAAACGATATCAGCGGAAAAGCGAGGTAAAAGTTAATAAATACCGCCAAGCAAATCGAATTGCAATTTGTGAT
      AACAAAGCGAGCATGACGGACTACACGGAATACGTGGAAACCGCCTGGAAGTATGCGGAATGGCTACCTTACCTCCTCGT
      CTCCTACGTGGTAGTCACCCTGCTGCCGAAGTCCCTCATCCGGATGAAACGCTTCGCGGACGCGGACTACGAGGCCAACA
      GGAACATGTTTCACCGCTGCTACGGCCCAGAGCTATGCTGCCACGTTCTGGGCCAGGAGCAGGTCGCCGGAAAGGTGAAG
      CCCAAGGCCAGGAAGCCAGTGACCCGGGTGTATCCCAAGCGTCAGCAGGTGGCGCCCAAAGCGGAGCTACCACCTCCTAG
      TCCAGCGCCCGTTAAGCGGAGCAACGTCACCAAGATAGCCAGGATGTTTGAGACGGGCAACACGCGCCAGGTGAGCCGCG
      TTGCGCCCATAACGCTTCCCGAGATCAGGATGTTCGGAGCAAGCGATGAGTCCAGAGACTCGACGCCCTGCGTCTCGCGG
      AAAACCAGCATCGCCAGTCAGCTCTCGGCTCAGCTGCAGCACATCGAGCAGACGATGCACCTGTGGCAGGAACTGGAGGA
      GGAGCCCTCCAAGAAGGCATCCAGCCACAACGATTGGGAGCCCATGGCAGTGCCGGTTCCAAGACGAACCCGTGGTACCT
      CTGCCACGCCCTCCACGGCCTCCCCGCTCTCCAGTTCCCCGGAACTGGAGCACTCCCGATCTCCGGTTCTCCTGAGGAAG
      CCGCCTTCCCTGTGCCTGCAGACCAGCATGGAGGATATATTCCAGGTGATCGCCCGGAGTGCCGAGGAGCCGGAAGACTG
      CCCGGACTGCCAGTGCCTCTCGCCGGTGACCAGCATCGATGATATTCTCTCCGAGCGGAGGTTCTCACGCCCCCTGTCCG
      CCTACTCCATCACCGATCTCCTCAACGAAGAGCAGGCCTCGTGTATCGAAGAGACCACGTACATCAACGAAACCAGATGA
      GGAACACGGTGGGATTGAAGGAACGTTTTATAGTGCCATCCCCCAGGGTCAGATGGAACAACCAGGTGAACTCCCATCCC
      AACCAGGCATTTGTCCAGGAAACAAAGCCACCGGAGACCTTGCCAAGTCCCCCAAGTCCACAGGAAAACGCCCGCATTTT
      GTTTGTTTAATCGACGGAAACTTAAGCAAATCAAAGTAAAGACTTTCCAACCTAAATCGCAATTGGCAATCGAAGCCTGT
      ACTTAGAATCCCAATCAATTGTATAAAAAACGTTAGTTGTGTCAGGAAACCGAATTCAAATTGCGAAGCATCTCATTCAC
      AGAGAACAGTACTGCTAAACTAATATGCTGATTGTACGTATTAACTTATGAATAAACATGAATTTGTATGGTAGTATTAC
      TTATCGTTAAATGTACTATATGTTGTAAATGAAAACTGTATTAAATGCAGCACACACACACACACACACACCTTATTATC
      GTATATTCTTAATAAAGAGAAAACACTGTATGCACAGCTGCGCCTGGGCATTCGAACAATTTT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0072921
      1840
      FBtr0072922
      1721
      FBtr0344219
      1882
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0072800
      315
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0072798
      315
      FBpp0072799
      315
      FBpp0310625
      315
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG1146-RA
      Secondary FlyBase IDs
        References (2)