Open Close
General Information
Symbol
Dmel\Eip63E-RC
Species
D. melanogaster
Annotation Symbol
CG10579-RC
FlyBase ID
FBtr0073135
Feature type
Associated gene
Evidence Rank
Length (nt)
2891
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 35 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATTTCGTGTGCGAAACTCAAAGCGGCAGGTTGTGCGTCCCGGCGAAAATATCCCGAAAATAACTTCCCAGAATTTGCGAG
      ACTTTCCGAAAAAAAAGAGTATAATATTTGACCTCGTTTACTTGCAACTTCGGCGTCGCCGTCTGATAAAAAAAACAAAA
      AAGAATTGATAAACCCATATATTTATACGAGAGTGTGTGCTGTGTTTGGAGCTCATATATATTTGCATCGGATTTGTGAC
      CCAGTGAAATTCCCGAGTATCCAGGAAAACCAAAGATATGTGTGCCATCAGCGAGAGTGTTAACCCAACTAAATAATCAA
      TTGAATAACATTGAAATAAACTTACCTGTGCGCCTGAAATTCGTCTTAAAGCAGAAACATGGCCGAATTAATCAGTCAGC
      CCACTAAAATTAACAACAATAATTTTGGTGCCGGCGTCACAATGCGCGAGAAAAAGGGAGGAGCCCTTCAGAAGCTCAAG
      AAGAGACTTTCGCACAGCTTCGGCAGATTAACAATTTCCCGCGAAGATGGCGACGAGTCGACGCACCACCATCACCACCA
      CCATCATCATCGCGGTGGACATGGCGGGCACCACAACCACGGTAACAAAGTTCCATACAACGGCTACAATTCGGAGGAAT
      ACTTGGACCGACTCGAACCGAATGGCAATATACCCGCTGACAAGACAAATTGCAGATATGGAGACTGGCGCAGCACGGAC
      AGCACCGACCACCACGATCGCGTCCAGAGACAGCTTTCCGTGTCCTCCGACAGCAAGTTGCTCGACGAGGACATTCGCGA
      GGAGATGAAGTACCATTCGCACGTGGTCATGCGTCCCAAGAAGCCGCCCAGACCCAAATCCGAGGTCTTTCTGAACAAAC
      AGGAAACGCATCCGCGCCGGAAACGATTCAGTGCATTTGGTGGCGACTCCCCATTTGGCAAGCAGGAGGCCTATGTTAAA
      CTCGAGCCGCTGGGCGAAGGCTCCTATGCGACGGTCTACAAAGGATTTAGCAAATTAACCTACCAGCGGGTGGCGCTGAA
      GGAGATTCGCCTGCAGGAGGAGGAGGGAGCACCCTTCACCGCGATTCGCGAGGCCTCGCTGCTGAAAGAACTGAAACACA
      GCAACATCGTCACGCTGCACGACATTGTCCACACGCGCGAGACGCTGACCTTTGTCTTTGAATATGTGAATACGGATCTG
      TCGCAATACATGGAGAAGCATCCGGGCGGCCTGGATCATCGCAACGTGCGCCTGTTCCTCTTCCAGCTGCTCCGTGGACT
      CTCCTACTGCCACAAGCGGCGTGTCCTCCATCGGGATGTCAAGCCGCAGAACCTGCTTATTAGCGACTGCGGCGAACTGA
      AGTTGGCCGATTTCGGACTGGCCAGGGCCAAGAGCGTGCCCAGCCACACCTACTCCCACGAGGTGGTCACGTTATGGTAC
      CGCCCTCCAGATGTCCTGCTGGGCAGCACGGAGTACTCGACCTCGCTGGACATGTGGGGCGTGGGCTGCATCTTCGTGGA
      GATGGTGACCGGGATGCCGACGTTTCCGGGCATACGTGATACCTACGATCAGCTGGACAAGATATTCAAATTGCTGGGCA
      CGCCCACCGAGGACACGTGGCCGGGAGTCACCCACTTTCCCGGCTACAAGCCACACAAGCTGGGTTTCTATCGACCACGG
      AAACTGGGTCACAACTTCCCACGGCTATACGACATCATCGAGGGCGAGACGATAGCTAACGGCTTCCTGCAACTGAATCC
      GGAGCAGCGTTTGGGCGCCGATGATGCACTGCAGCATCCGTACTTTGCGCAGTTGCCAAAGAAACTCTACGAATTGCCAG
      ACGAAACCTCAATTTTCACCGTGGAAGGCGTGCAGCTTTACACGGAGCCAAATCGACAGAATAAATGAAAATTAAAGCAA
      GTCCTCTCTGTGGATGGCGTACGTTTCTACTGTTAGGATCCAAATCACCCAATCAACATCCTCCTGGACTATCAATCTGT
      CAATCAACCTATCGCATCATCCAGCAATCGACAGCCATATATAATGCAAGAGGAACTTCTCGCCCGCGCAGAAGTTTTGT
      ACTATAATTCTATGATACTTTTTAGTTATTAGTTCGATTTCGCAGTGAGTTAGCTGAGGGAGTTTAGCAGAAGACACGGC
      ACCAACGGCAGCATTTTATTTTCAGTCAAATTGCTTAAAGTTAGTTTAGATTTCTGTAGATTTCTCGCCATCCTGCAGCC
      GCGTCGTAAAGGATACTCAGTTTAGTCAAAGCGCAGACACGTTTTTCTGTATTCTTTTGTAAGCTAACAAAAATTTACAT
      TTAATGGTAGCTTTTAGTGAGTGAATTGCCTCTGTGGATTACGCAATATTTTCGATTGCAATGAGTGAGAGATAATCATC
      ATGATGTTTGATATGCTCGTGTGTATTTCGTTTTCATTATTTTTTCCTTTAGTTTTTATTCGATATTTTCTACGCGAATG
      TTCGACTGCGGAGTGTTGATTAAAATTGCAAATATAAATTCAATTGGTTACTGCTTTAATAGAGTGCAATTAATAAAAAT
      TAATGAATTGGCGGCAATGCGCCAAAAAAAAAAAATGAATCAATTAATCAAATAATGATGTGCTCAAAAGGTGTACGATT
      ATTTCCAAGCAATTACTCAACTTAAAATTATGCACATTTTCAAATTAAGACTTGTTTAGTTCTGCTCACAGCTCCTTTTA
      ATTGTTGGATTGTATAATTTTGTAACGTTTCCTTTGTCATTTTAAAATATATCAGTTCGCCGCGCTGTTTAAGTGATAAT
      TTTATAACTATTAAATGAATTTATGTAAAAAGCAAGTAAATCAATTATTAACAATATGTAAAACAATAAATTTAAACCAT
      TTATACAATTT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0073133
      2700
      FBtr0073134
      2919
      FBtr0073131
      3575
      FBtr0073132
      2981
      FBtr0110920
      3536
      FBtr0110921
      2958
      FBtr0110922
      2625
      FBtr0110923
      2739
      FBtr0110924
      4769
      FBtr0110925
      2930
      FBtr0301948
      3311
      FBtr0302598
      4914
      FBtr0330068
      3575
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0072994
      509
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0072992
      509
      FBpp0072993
      509
      FBpp0072990
      522
      FBpp0072991
      522
      FBpp0110220
      509
      FBpp0110221
      522
      FBpp0110222
      501
      FBpp0110223
      522
      FBpp0110224
      509
      FBpp0110225
      522
      FBpp0291160
      522
      FBpp0291754
      509
      FBpp0303101
      538
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG10579-RC
      Eip63E-RC
      Secondary FlyBase IDs
        References (2)