Open Close
General Information
Symbol
Dmel\SmydA-4-RA
Species
D. melanogaster
Annotation Symbol
CG11160-RA
FlyBase ID
FBtr0073390
Feature type
Associated gene
Evidence Rank
Length (nt)
2093
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 13 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ACAGTTGCAATTTGTGCCTCGCGGTTCGAACAACGCGTGGCCAGAGTTTTTATTTATATACAAATATATATACACACATA
          TATATATATATATATTTTTTTTTTATTTGTTGTTATCTTCGATTCTTGAATTCCATTTCCCATTTGGTTGTTTGTTTGGT
          TTTCCCAGTGCAATCTGCTGACACATTTATCCGACGCGATTTACACGGCGCAATTAATTGACGAGTTGTTAAACATATCT
          ATTAAATGCGAACGGCCTTTTGAATAACTCGTGTGCACCGCGTTAAAATTATCAATTAAAATCAATTAACAAGCTGTGCC
          GCGGAAATAAAATAAAATCAAATTTAAATACAAATAAAAGCGATGCCGGGAAGAAAAAAAAACCACCACAAAAACAACAA
          CAACAGCAGAGCCAGACACCAGCGGGGTGGTCAACAGTCGAAGGATAAGCAGGAGCAGCAGGACAAGGAGCAGAGTCCCT
          CGCCAACGGAGGAGAAGGAGTTACCATATCGCGTAGAACACTCCGATATATATGGACGATATTTGGTGGCCAATCGCCAA
          CTGGAGGCGGGCGAAACGCTGATCCGCGAGGAGCCACTGGCCATTGGGCCGTGTGTGAGCGGTGATCCCGTGTGCCTGGG
          TTGCTATCACCCGGTGTCCCTTAAGGCGGATCAATATCGTTGTCCCGGCTGCGCCTGGCCACTCTGCGGCAGCACTTGCG
          CTGGCCTCAAACATCGACATGGTCACACTGAAACGGAGTGCCAACTGTACGCGGAACGACGGGCGGTCGCCGGCGAACTG
          CTGACGGAACGCGCCGGTCCGGCGGAAGTGCGTGACCTTTACGAACTGGTGATGATCGTTCGCATACTCCTCCTGCGCCA
          GCACGATCCGGAGCAGTTCGCTCTGATCGCCCGCATGGAATCGCATACGGAGGAGCGACGACAGAACGCGGTGCTGTGGC
          GCCACTACGAGGAGAAGGTGGTGCAGCGACTGCGCGTCACCTGGCAGCTGGAGGACCTCGAGGCGGAACAGGTGCACGAG
          GTGTGCGGCATACTGGACGTCAATTGTTTCGAGATCGGCCAGAATGGCGCCAAGGCGCGGACGCTATATCCGAGCGCCTT
          CCTGCTCGCGCACGACTGCACACCGAACACGGCGCACACGGACGACCCGAGCTCCTTCGAGATCCTGCTGCGCACCTCGC
          GGCGCGTGCGCGAGCGGGAAGCGCTGACGCTCAGCTATGCGTACACGCTGCAGGGCACACTCAAGCGGCGCGCCTTCATG
          CACGAGGGCAAGCTCTTCTGGTGCTGCTGCCGGCGCTGCTCCGATCCCCGCGAGCTGGGCACCGACTGCAGCGCCCTCGT
          GTGCGCCACCTGTCGGACGGGATCGGTGCGAGCGGTGGATCCACTGCAGCAGACCGGCGACTGGGCCTGCGACCGTTGCG
          CCCATAAAATGGGAGCCACGGAAGTGGAGCGCCAGTTGGATCGTATCAACAACGACCTGGAGGACATTGATGTCCACGAT
          ATTCCAGGACTGGAGAACTTTCTCCTTAGATATCGGGATGTCCTGCGACCGAATCACTACCTCCTGCTCTCGGCCAAATA
          TTCCTTGTGCCAGATTTACGGTCGAACTGAAGGATACTTACTGCCACAGATGTCCCCAGAGGACATTGCCCGCAAGGAGA
          GCTACTGCCGCGAGTTTCTGGAAATCGTAGATGTACTCGATCCGGGTCTGACCCGTCTGCGAGGACTCATCATGTACGAG
          CTGCATGCCCCCGTAATGGTTTTGGCTCAGTCGGCATTCCAGAGCGGACAGATCTCACGACAGGAGTTCCAGCGGCGACT
          CAAAGAGGTCGTCAAGCTGCTCCAAGTCAGCAGGGATATCCTGCTAATGGAACCCGAAGGATCTACGGAAAATGCAATGG
          GACAGGCTGCAGCCGATGCGCTAAGCAAAATGGGTTGCTAGTCAAAAGGGGCTCTTTAGACTATTTGTAAATTAACTGAG
          TTTATTTTAACACCAAATGTATCTCAAAATTAAAATACCAGATAGTCCGGTATGGGTTAATTAGAAAATATATATGATTT
          TCAAAGGAATAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0073391
          2433
          FBtr0331720
          2106
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0073246
          532
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0073247
          403
          FBpp0304109
          369
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG11160-RA
          SmydA-4-RA
          Secondary FlyBase IDs
            References (2)