Open Close
General Information
Symbol
Dmel\CG1637-RB
Species
D. melanogaster
Annotation Symbol
CG1637-RB
FlyBase ID
FBtr0073406
Feature type
Associated gene
Evidence Rank
Length (nt)
2196
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 74 )
Sequence
CCAAGGTCACACTGCACCCGGATTGTTTTTGTTGTGGCTGCGCTTATAAATTGCTGGATATTTCCATATTAGTGCTCATT
TTTTGTTGTTCCCGCAAGCGAATTTGTCGATTCCCCCGTTTAACTCCAACGACTCCCCGAGCCAAGTGTCCCCACTTTGA
CAACGACGCAATTGTGATTTGGCAATGTTTTTGCTGACTGCGTTACTGTGCAACAACAAACACAAGTAAATACAAAACGG
TAAAAATGCAGAGACTGCAATTCGCTCTGCTAGCGTCGCTGCTCCTGCTGGTGCTGCTTCTTCCGGGGATTAGGAGCACT
CCCATCGACCAGGACGTCGACATTGTTCACTATCAGCCGGAGCAAGTGCATCTGTCCTTTGGAGAACGCACCGATAGCGA
GATAGTCGTCACTTGGTCCACGCGCAGCCTGCCGCCGGATCAGGAAGTGGGTGCGGTCAGCGTGGTGGAGTACGGTCAAC
TGGTAGACGGACAGGTCAGGCTCACCCAACAGGCCCGGGGAAAGGCTACTAAATTCGTGGACGGCGGTCACAAGCAGGCC
ACGCAGTTCATCCACAGGGTGACGCTTAGGGACCTGGAGCCAAATGCCACATACTCTTACCATTGCGGTAGCGATTTTGG
CTGGTCGGCCATCTTCCAGTTTCGCACAGTGCCCTCGGCATCCGTTGACTGGTCGCCATCGCTGGCTATCTACGGGGATA
TGGGCAATGAGAATGCCCAATCCCTGGCCCGATTGCAGCAGGAGACGCAGCGCGGCATGTACGATGCCATCATCCATGTG
GGTGACTTCGCCTACGACATGAACACGAAGAATGCTCGCGTGGGGGATGAGTTTATGCGGCAGATCGAAACGGTGGCTGC
CTACCTGCCATACATGGTGGTTCCCGGCAATCACGAGGAGAAGTTCAACTTCTCGAACTATCGTGCCCGCTTCAGTATGC
CGGGAGGTACGGAGAACATGTTCTACAGCTTCGATCTGGGACCCGTGCACTTCGTGGGCATTAGCACGGAGGTCTACTAC
TTTCTCAACTATGGTTTAAAGCCGCTGGTATTCCAGTTCGAATGGTTGCGTGAGGATCTGGCCAAGGCCAATCTGCCAGA
GAATCGGAACAAGCGTCCGTGGATCATCTTGTACGGTCATCGACCCATGTACTGCAGCAACGAGAACGACAATGACTGCA
CCCACTCAGAGACTCTCACGCGGGTGGGCTGGCCATTTGTACACATGTTCGGATTGGAGCCGCTGCTTTACGAGTTCGGC
GTGGACGTGGCCATTTGGGCGCACGAGCACTCCTACGAGAGACTCTGGCCCATTTACGATTACAAGGTGCGCAATGGAAC
GCTGAAGGATTCGCCGTACAATGATCCTAGTGCCCCTGTGCACATCGTCACAGGATCCGCCGGCTGCAAGGAGGGAAGAG
AACCATTCAAGGGCAAAATACCCGAATGGAGCGCTTTTCACAGCCAGGACTATGGTTACACACGGCTCAAGGCTCACAAT
CGAACACATATCCATTTCGAGCAGGTGTCCGACGACAAGAACGGCGCCATCATCGATGACTTTTGGTTGGTGAAATCCAA
GCATGGAAGCTACCGAAACTAAATAGTCATTCCCAATCTGAACCATAACCTGAGCCGAATCAATTCAAGCTAAAGGAGTC
TCTCGAGGCATTACACGCATCAATAGCAACAGGCAGTATTAGTAGCGCACATTCGCCTCGACCTGATTCGATCACAAACT
ATAGCAATAAGCGTGGCACATTCCTTATCCAAATATCTCAACCCAGCCCGAAACAAACTACAGTTTTATACTTAGCCAAT
TTAACAAACGCAGCATTTACACATATGCAAGCGCTTTTAAGTGTGCATTTAACATAAGCTGATAAGAACGTAAATGAACT
TAGTTTCTTATCTCTGTCGCATGTTACTTGATGTTCAAAAACTGGTACTCGGTAACTGCTGTCTTAAGCAAATTGTTTTT
AATGTGTATGGGATGTACTTGATATACTTATTAGGATCAATGTTAAAGGACTAATGGATATGCACCCGATCGGTTTTTAT
TATCAATAAGTACATGAAATCCGATTACCGGGTTTATTATAGTCACGGCAATCCGATTGTACACTGATTGTTGTTTAAAT
GCCTAGTATCTTTACAATAAATGTCTTGAACTTTTC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0073408
1773
FBtr0073407
1708
FBtr0339836
2199
FBtr0346382
1868
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0073262
458
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0073264
453
FBpp0073263
450
FBpp0308868
459
FBpp0312076
453
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG1637-RB
Secondary FlyBase IDs
    References (2)