Open Close
General Information
Symbol
Dmel\CG1737-RA
Species
D. melanogaster
Annotation Symbol
CG1737-RA
FlyBase ID
FBtr0073453
Feature type
Associated gene
Evidence Rank
Length (nt)
4280
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 33 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CTCTCTTTCCAGTTCCATTTTTCCATCGACAGCGAACCATTTCGAGCGCGCCAATCATAATCGTGTTAATCGTGTCAGAA
      AGCAAATACAAATTGGTGCGCACATTCAGCTGTTGCAGTTACAGTCGAGCCAAACGATTTGTGTCGCCGATCGCGTGGAA
      TTTCGCCAGCAAAACGCCGAAAAAAGCCCTCGAGAAAAGCAAAAACACACAGGGTCGCTGTGCATGTGTGTGTGTGGTAC
      AGTTGGGTAGAAAATCATCGCCAGAGCGAGTTGCCACCTGGTTGCGCTGCTCCTCTCTCTCTTTCTCGTTCGCTCGCATT
      TATAATTTTTTTTCTTGTTCCGCCACTATTGCCACCACTTTTGCTGTTCTGCTTTCTGTGCAGCAGCTCAGTTGTTCAGT
      TCGGTTGTTGTTATTGTGTTGTGCATTCTGGCGTTTTGAAAACATTCTAAATAGCAATAGGCAATCTCTTGCCCAAAGCC
      CAAAAAGGAAGAAAATATAAAAAACAGTTGCCAATTAAGAGTGACCATCCGCAGCAGCAGCAGCAGCAGAGTTGCAGCGA
      GAGAACAATAAGCAAAAGAGAGAGCGCGGGCTTGTGAAAGTGCCAGCGAAAAGTGCGATTAAATTGAAGGCAAGCTTAAC
      GCCCGAGAAAATGTTAAGCGATTTTCGAAGCTACCCATGAAAGATGCGGGCTGGAAAAAAAGAGGCAGCTGAAAGCGTTA
      AGAAGACACGTAATTGCATCGTCTACGTGAGGAATCTGTACGACGAGTCGTCTTCGCGTAAAGACACGCCAGCCGGCAAA
      CTGAAAGGGAGAGATAACCAACGGGAGGTGCAGCAGGAGCTGCGTGGGACCCGCACCACAAGACGTCAATCCGTCGTCCA
      GGAGAAGCCCACTCCGCGCACCAGGCACGCTGTGAAGCCAGCAGCGTTATCGCCATCACCATCGTCGCCATCGGCGCGTT
      CCAAGCTCAGCAGGGAGTCGGCCGTCAAGGAGCAGCCATCCAGCAATCTGGCCAAACGACGCGGCAATTTGCTGCTGGGA
      GGCAGCAATCATCCCCTGTCCATTAGTCCTCACAAGTTGGGTCTGGACAAGCCACAGCGACGGCGATCCGTTCAAGCGGA
      GACGCCGAAGATGTTCAAGGTGGTGTCCAGCAAGCGCGTATCGACGAGTCCGCCGCCCACCATTGCGGCCAGTCGTTCGC
      GCCGATCGATCAAACCGAATCCAAAGTATGTCAGCGAGGATATAGTGACGCCAAAGTACTTGGCCGCCCTGGCCGATGGC
      GGTGGCCAGTCCATCGGCACGAACGACAGACGCTTGGTCCGCCTGCCGCGAGATGAAATCAGCGATATGCTGGAATTCGA
      AGAGGACGATGATGACGAAGTGGCGGACGCCGCCTTCAATCCGCAACTGCACAAGTCCGACGATGACGACGACGACGATA
      TAAGCGAGGCCGAGTACGAGCAGGAGCTGCGACGCAAACAGCCGCCCGTCAAGCGTGGACGTGGACGTCCACCGAAGGCG
      AAAAATGTCAATGCCAATGCCAGCGCGACCAGCGCTGGCAATCTGACTTCCAGCAGCGGCGCCACATCCAAGATATCCAT
      AAATTCGAGCAGCGGCCGCACGGCGTCCACTAGCCTGCAGCAGATGCGTCGCACAATGGCCACGAATATGGCCAAAAGCA
      ATGCCAGCATGACAGACGGATCGAGCACGGGCAAGGGCACTGCGTCCGCCGCGGCCAAACGCAAAATGGACACTAGCGAA
      AGCGAGAGTCCTGTGCCACGCAAGCGCATAATCATTTCGGGCGGCTCCCAGCAGCGCAGCGGACCGCCTGTGGTGAATGG
      TGCCAACAGCAAGATGAGCGCGCAGAGAGCGATCACGGCGCGACCGAAGGTGGGCCAGGCGGGCAGTGCGTCAGCCAGGA
      TGCTGCCACAGCGACGCGGCAGCAGTAACAAGATAAACTCATTGTCGAACTCCAATTCGAATTCGATTAGATCCACGCCC
      GCAACGCGCTCAACTGGCGGTGGTGGTGGCGGCGGCAAGGGTGACGCTAGCAATGATGGGAAAAACGATTCCGAATCGGA
      GGATATGCCCACATTCACCATTGTAAACATCGATGACATTATCAATCAGGACGATGTGCTCATTTCCAGATCACACACTG
      CTATGGCCGCTTCCGCAGCTGGCGGTAATTCAATCAAAAAGGTCGCTTTGGGCAGGCCCCGTACCAAGAATATCGGAACC
      GGCAATTCGGTTGCCGGCGATAAGAAATCCATCACTGTTAACAGCACGCAGAAATCCCTGTCCGCTGCTGTTAACCACAA
      CAATACGACGGCGGGGAATCCAGCCAAGCGCATCAAGATCTTGGCCAGCAACAGTAGTGTCAATACCAAAATGGGACCAG
      TGCATATCCAGAGTCAACTGCCGAAGCCCCGGCCCAGGATACTCAACGCGGAAATGGGCAAGAAGACGCAGTCGATGAAA
      CCGCTGATGAGCATGGGCAAGGAGCTCTGTCCCACGGACGTCGACACCGAAGAGGACGATCCGGATCCAGATCTCGATTT
      TGATATCGATAATATACCGGTATCTATTGTTACCCGTAAGAATGCCAATGTCAATGCCAATGCCAAGTCCAAGCAGGTGA
      CGACAACGACGTCGGTGGCGGCGTCGGCGGCGATGACGTCCGCTCCAGCAGCGGTAGCGGTTAACAAGTTGAACAACAAT
      CGGCGCAATGTGCTGTCCACGACAGCGTCGTCGGTGAATGCGCTGATTGCGGACCGGAGGCTGAGCAATCTGCTGGCCGA
      TAACGATGTCCAGCCGGTGTTCAAGAAGCCGAGCCTGGTTCCGCAGCGTCGCAGCAAGGAGAACCAGCAGGAGCAGCAGC
      GCGACAAGGAGCTGACAACGCTGCGCGAAATATTGCCCACCGGCGGTGGCATCGACGATGCCAACAGTCCCAAATATTTT
      CCGCCCGAGACCACAACGTTTCACGAGGAGGATGGTCGTGTGGTAAAGAAGATCACCTGCTATGAGACGTGGCATGTGGT
      TAGCACGGCCAAGGATATGTTGTCGAAGATGGCGCGCCAGCAGCGCACCTGCCTGGAGCTGGCGCTGGTCAAGCTGGCCA
      ATGTGGCGTCACGGATAAAGGTGCCATCGGGCAAATGGACCAGCAAGGTGACGCTGTACAAGGTCTCGCCGTCGATGATG
      CCCCGCCAGACAATGACCATCTTTACGGGCGATCTCAAGGCGTACAACATACCCGAGGAGGACCGTCACAAGTATCAGCC
      GTCGTGCGTGCTCTTCCGGCGCGTTGTCGTTGACAAGAACACGTGCCGCGTGCCCTACGATCGGGCCGTCATCTTCAAGA
      ACAAATGCTTCTATGCGAACATCGATGGCAAGCATGTGAATCTGTTGGGTGCCCCCGAGACGGTTGCCACCATCAAGGAT
      GTGGAGATCCTGCTGGATATCGTCGATCGCCTCTCGATCAGCAGCAACATTGTCGAGCTGGTCAACGCTAAGTGAGCGTG
      GAGGCCTGGTCCATGGTGGCCACAGGAAGAGCACGTATCACATTGTAAAAAATAATTCACACACAGCACTCCCCTCCCCA
      TCCCCATCCCCCTCCCCCATACACATACACAAACAAACAAAGCGGACACTCGATAATTCGTTTTATGCTGTAGTTGTAAT
      AAAACAGATACAAGTTTTTTTTTGTAAAACCATTAACTTAGTTGTAATAGCTAGTGTAGCGTAAATTTATATATATTTAT
      ATGTATATATATATATGTATGTATATAAATATATATTAATATATATACACGTATATATAATTATATATTTATATATATGA
      ATATATATATATATATATTTATATAAATTTTTATATATATATATCTCGTATATTATAAACAGCGGACGGACATACATAAA
      TACAAACGGCAGATGTATCTATGTAATATAAACTAAACTAAAGAAAACAATTAATTGTAAAATGCTCGCCCAACTCTCGA
      AGGGATTGCGAAGTTCCGGGCGGTCGAGGTATATCAATAATGATTTTTATTTTAAATGCGTTGGAATACATAGCCCCCCT
      CCGCCTTCCCCGCGAGTCCCGCCCCCTTCGAAATCCTTTTTTTTTAAATTGCTATTATCGTAGTCGATTCAATAATATAA
      AACCGGGCGTACATGTGCCTACGCCCGCGTGGAGGACTAGCCAGTAAGTTAGTCGAGTGTATATCTAAGTGATCCCAATT
      CAAAGCATACAAATAAAAGAGAAAACTGATTTAAATAACG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0340049
      4369
      FBtr0340050
      4223
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0073309
      943
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0309056
      943
      FBpp0309057
      924
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG1737-RA
      Secondary FlyBase IDs
        References (2)