Open Close
General Information
Symbol
Dmel\Tomosyn-RC
Species
D. melanogaster
Annotation Symbol
CG17762-RC
FlyBase ID
FBtr0073678
Feature type
Associated gene
Evidence Rank
Length (nt)
5490
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 40 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    CTCGTTCTCAATTTTGCAGCAGCAGCAGCAGCAGCAGTAGAGACAGTAGAAGCAGTAAAAGCAGCAGCAGCAGCAGCTCA
    GTCGACAACTGACCAGCCAAGCACTAGCATATTTCCTATTGGCCCCTTGCAACAAAAAGCCCCGAAAATATATTGAAAAT
    TTCACAAAAATGGTAGAAGCCAAAACTGTGAAAAACTAAAGCGAACGTCTTGAAGCCATTAAAAAAGCGCGCCTATTCAG
    TGAATGTGTGTGTGTGCGTGAGAATTGATGTGTAAAAAGAACAGTGTATTGAAATATCAATAAACTATCGATGATCCTTT
    GAAAATTAAGAAAAAAAATTTAATTTTTTTTTTGTATGTTCAAGTGAAGAAGCTGCAGGAGGAGCATAAGATGAAGATGT
    AGCTAACATCAAATATTTCGACCACTGTTAACCTAGTTTCACATCTCAAAAATAAAACCAAACAACAAGGACGAACTCAG
    ACCAGCACTGGCTCCTCTGTCTTCAATTACGCACAGCTCTACCAGTATCTAGAGAATAACGAGTAAAGGCTACCAAGGAC
    TCGAGGGAAGAGAATCGCCTGGGGCAGAGGAAGAAGCCAATCCCCATACTTTTCGGTTCTCCTCGGACCAGAATCATCAC
    CTCCCCCATCCCGACCCCGGCACTACCTTCCCGCTGAACCACATACACTCTGTCCACTATCCACTATTCGACACCACCAC
    ACTCTGTGCATCCAACTATTTGGCCAACCATTAATCCTTGGGCGAGACCAGAGCAGCCCCATCGCATAACTGTGGATAGC
    AGAGCAGCCGGAGCACGAGGACGACTCATGTTACAAAAATGAAAAAGTTCACATTCAAAGGAGTTCTAGATGGATTTCGA
    CAAAGCGTTCAGCCCCAAGCCACACGACAGGAGCAGGAGATTCAGGAGCAACTCAAGGCCGATCACTTTACGTTAAAGAA
    AACCTTTCGCCATGGCTTTCCATACTCGCCCACATCCTTCGCCTTCGATCCAGTACAAAAGCTACTAGCGATTGGCGACA
    AATCGGGCTACATTCGCATTTTGGGACGACCTGGCGTCGATGCCCATGCCAAACACGAGGGCGAATCCGAGTGCGCCGTG
    CTCTTTGCCCAGTTCCTGGTCAACGAGGGCGCATTGGTCACCGTCACCGCCGATGACACCATTCACTTGTGGAGCATTCG
    CCAAAAGACACCGCGCATTGTGCAGAGTCTGAAGTTTCAGAGGGAGCGCGTGACTTGCATACACCTGCCTGTGGGCAGCA
    AATGGCTGTACGTGGGCACCGAGAAGGGAAACATACACGTTGTTCACATAGATACATTTGCACTTAGTGGTTATATTATT
    AACTGGAATAAAGCAATTGAAGTGGTTAGAACTAGTCATCCAGGTGCTGTGATTGCGTTATGTGATAATCCATTGGATGC
    AAACAAGTTGCTTATTGCATTTGAGTGCGGGCTGCTTGTGCTGTGGGATCTGAAGGCGAAATGCGCTGAGCTGCGATGGC
    AGGCGGCCGAGGCCGTCAAGTCCCTGGCCTGGCACTACGAGGGCAAATATTTTGTGTCCTCGCACACGGATGGCTCCATT
    TGCTCCTGGCCCACGAAGCCGCAGGCTAAGCCGCAGTCGCAGGTCTGTCCGCATGCTAAAATCAACAAGGATGGCAATGC
    GGAGAAATGCAAGCCGATATATAAAGTTGACTTGAAGTCCAGCGCAACTGGGGAAACCTTCACAATTTTCTCGGGCGGCA
    TGCCCTCGGAGAAGGGCTCCAAGTCCAACTGCATCACGGTGATGGTGGGCAAGGCCACCACGGTGCTGGAGATGGAGCAC
    GCCGTTTGCGATTTCATAACACTCTGCGAGAATCCCTGGCCCTGCGAGACCCAGGAGCCGTATGCTATTGCCGTGCTGTT
    GCAATACGACTTAGTATTAATAGACTTATTAACACCCGGTTTTCCATGTTTTGAATCGCCTTATCCAATGGACTTACACG
    AATCACCTGTTACATGTTGCACATATTTAACCGATTGCCCATCGGATTTGGTTCCTGCTTTCTATTCAGTTGGTCGCACA
    ACGACAAGTAAAAAGAGCTGCTTCTCGGAGCGCGAATGGCCGATATCCGGTGGCGAGTGGTCGCCGGCGTCGTGCAGCTA
    TTCGGAGATCGTGATCACCGGACACCAGGACGGCAGCCTCAAGTTCTGGGATTCCGGTGCCGGCACACTGCAGATCCTCT
    ATAAGCTGAAGACAGCCAAGATGTTCGAGAAGCCGCGCTCCCACGTCGCCCACTCGCATCCGGAAAGCGACAATCCGCTG
    GCGGTGCACCTAATCTTCCTTTGCTCGGAATCGCGACGCCTGTGTGTGGCCGGCGCCATGGGACAGGTGATGCTCTTCAA
    GTTCCGCAAAGTGGAGTCCACGTCGGAGGTACTGGTGCTGGAGATACCCATACTCTATGAGAATTTTGATGACATTTATG
    GGACAAGTCCCGAGTGCGATTTTCTAACGGGCCATCAAGTGCAGAAGGCTGAGTCGAGTGATTCGGATAAGACGGCCGAG
    TGTTCGCTAAAGGTGCGCAATGGGGCGCAACGCAAGCCGCCGGGCTTCCAGTCGCAGCTGGTCTGCCTCACCACCGGACC
    AAATCGCCGGAACGTGCAGGTCACCTCGCTGTGCATCAGCTCCAGTTATGGCCTAATGGCTTATGGTACCGAATATGGAC
    TTGTCATAATTGATATAATCCAAAAAATTTGCCTATTGAGTGTTGCATGCCCCGATCTGTATGGCGCACATGATCCTTAC
    TCGCGAACACCAAAAAGTCCAAAACGTATTGAAAACAAAGAGGAGCAAAGCCGATCGCCCAGCTCAGATCAGCTGAACGA
    CACGACCAGTCCGGATAGTCCGTCTCTCGAATTTGTACCGGAGGCTGGCGAAACATCGGCCCACGATGGCGTGGCGACGG
    CAACTAGCTCACGTCCCAGTTCACCGGACCCGGTGGTGAACAGTGCTCGTGAAACGCTGCTCAGCGGATCGGCAGCGGCA
    ACGGCGGCTGCGGCAGCATCGGCGGCTGTCATGATGGCCAAGAGTCCCCAGCGGGATGATGCAGCTCCCAAGGAGCTGCA
    GGACAGACGAAAGTCCATGTCCTGGAAAACGTTCAATTTGAAGCGTCAATTATCGAAAGTCAATATGAAGATCGGCGGCC
    TGAATGTCAATACCGATATGGAGTCGCTAAAGAATAGCTCCATTTTCTACACGCCCAAGGAGGTGTCACCGGAGGCTGCT
    ACGCCACCGGCAACAGAAGAGGAGGCAACGCCGGAGGGCAAGGAGGACGAGTCCCTGGATGATGGCGAAATGGCGACCAA
    CGCGGGAGCAGCAGCAGCTGCATCACCATCGCCGGCAGTTCGTGGCAAATTTCGCTCATCCACCACGGATTCACCTGATG
    AGGGCGCCAGCAGTAGCATTGCCAGCGGCATTCGTCGTGTGGACTTTGAACAGCCGGCTGGGGTCGAGGTGGAGCGACCA
    AACAACCTGCCACTGGCGGATGCACCAGCTCCACTGAAGCCCGCCCGTCAAAAGTTCAAGGAAAAGTCGCGCGATCAGCG
    ACTTTTATCCGTTCCGAACATTAAGTATCAGCCGCGAGATTCGCGTGGCGGTGCTCGGAACCTCAAGAATGATGTCTCAC
    CGCTGATGGGCGGTGGTGGCGGTGGAGGAGGCGTTGTTGGTGCCAGCAGCGGCATTGGTGGAAGCGTCGCTGGAGGCAAG
    AAGATACATAAATTGGATGGAACTTTCTCAAGATCCAGATCATCGTCAATGTCCAGCATTGATATGTCTTCCTCTGAATC
    TGTTACCTGTTTAGCTTTTATCGAGAGTTATGCAAAACGAAATGATATTTTGACACTTGTTCCTACTTTGTGGATTGGAA
    CTAGTTTCGGTTCGATACTGACATTGTTCATCACCATGCCCGAGCGAGATGTGCGCAAATCTCAGCCAGTATTGATAACA
    ATAAATGGTGGCCCCGTGGTACGACTCAAAGGATCCATAACTTCCATGTCTTTTTTAGACTCATACGGTTCGATCATACC
    CTATACGTTTGAGACCTGGCGTGACGAGAAGAGGGACAACAAAGATCGCACACCAACAAAGAGCAGCAGCCGCACCAGTC
    CCACATTCACACCGACAACTGCCAATACATTATCAAACACTTCGGTCGCGGGTGGTGCGTCCGCAGGCGGAGGAGCTGGC
    GGCGGTGGTGGTGCCGGCGGTGGTGCGGCCAGCGGTGGCGCAGCCGCAGGAGGGCCAGCCGGCGGTGGTGCCGGAGCAGG
    ATCGGCGGCTGGAGCGGCCGGCGGCGTTGGAAGCGGTGTAACCAGCGGCGGGGGGATGAGCAGCAGCAGCGCCAGCAGCA
    GCGGCATCAGCGGAAGTGTGAGCACCGGCCTGGAAACTCTCACCGATCGACAATACATCGTTATCGCAAGCGAGAAGCAA
    ACAAAAGTCTTCGATGTCGCCAACCAGTGCTGCATCAACCGCATACAATTATCGGAAATGGATTTTGCAGTCAAGGCAGA
    AACTATCACGATGAAAGATGGCTCTTGCTTAGCAACCTATCTTTCGAATGGCCATCTAATGGTACATAGTCTTCCTAGTC
    TAAAACTGTTATTGGATACTGATTTCTTACCACTTATGGAACTAAGTTTTCAAACAAAATGTAAACAGGGAATTGTGGAT
    CCAATGCTTTCGATATGGGGTCAACAGATCATTGTTCATGAAGATACAACTCAAATATCAAAAATATTTTGCTTTAGTCA
    TAAAGGTCATGGATTGTACATGGCATCGCCCACCGAAATTCAAAAATTCACGATATCATCGGAATTTTGTCAATTTATTT
    TGGAGATGATGGGTGAACTATATACGGTACACGAAATGCCCGAACAGCCGAAGGAGGGTTTCTTCAAGGGTCTATTTGGT
    GGTGGCGCCAAACTCCTGGATCGCGAGGAGCTATTTGGCGAGCAGAGCGGGAAACCGAATCGATCGGTGGCACGGCACAT
    ACCCGGCCCCAATTTGGAGCAGCTCGGCCAGAGGGCTTCCACCGCCGCATCGGAGATCAGCCGGGCGCACCAGCTGGCCA
    TGGAGCGCGGCGAGAAGCTAAATTTGCTGGAGGAGCGCGCCGAGCGCATGGCCAACACTGCTCAAGATTTCAGCGGCACT
    GCGCATCAATTAATGCTTAAATATAAAGACAAGAAGTGGTATCAGTTGTAAAATATCTATTTTAGGAGCCAATTCTACCA
    CAGTTATTGTAATATTGCTTTTATAACACTTTCTACTACATTACGAGTAAAGTACACTTATTTAATTTCTGTTTTCAAGT
    CGTCACGTTATTTACAAAAACCGAAAACCAACAAAAAAAAACAACAAAAACCGAAAATTCACAAAAACAAAAAAACTGAA
    AGAGAAAACCCAACCAAAAAAAAACTGTTTTTAATAAAAATATATAGACC
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0300375
    5290
    FBtr0307898
    4541
    FBtr0307899
    5330
    FBtr0307900
    4687
    FBtr0340406
    5041
    FBtr0340407
    5062
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0073511
    1470
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0289604
    1470
    FBpp0300332
    1254
    FBpp0300333
    1470
    FBpp0300334
    1254
    FBpp0309352
    1387
    FBpp0309353
    1387
    Comments

    Extended 3' UTR based on RNA-Seq and/or EST data.

    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (3)
    Reported As
    Symbol Synonym
    CG17762-RC
    Tomosyn-RC
    tomosyn-RC
    Secondary FlyBase IDs
      References (2)