Open Close
General Information
Symbol
Dmel\CG1640-RE
Species
D. melanogaster
Annotation Symbol
CG1640-RE
FlyBase ID
FBtr0073772
Feature type
Associated gene
Evidence Rank
Length (nt)
2357
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 135 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TATTTTTAAAACTTAATCGCTGCCCGCTTCATCGTGACTTTTGCCCGCAAGAAAAACATATAGTCGAAATAATGAGTCGA
        ATGCTAATTAAACCTGCTGCCGCCACAGTTTCGGCCGCATTGCAGCAGCACCAGCGCCAGCAGCAACAGTACGTTATTCG
        CCGCTGGAAATCGTTCCTGCACAACAACAGCAACAATGCCAATCGACGTGCGGCGAAATCAACGGCAACAGCAACGGTGA
        CGGCAGCAGCGACGTCGCAGCGCCATGGAACAAGCGGCGATTTCATTCAACCGTTAGACGTCCGCCGTTCCTTTTCAACC
        AGCCACAAAATGCCGTCGTCGTCGAAAGCGCTCACACTGGATAACATAAATCCCAACTTTATTGCCATGGAATATGCCGT
        TCGCGGTCCTCTGGTGATTCGTGCTGGGGAAATCGAGAAGGAACTGGAAAAGGGTGTCAAGAAGCCATTCGACCAGGTGA
        TCCGTGCCAACATCGGTGATTGCCATGCGATGGGCCAGCAGCCCTTGACCTTCCTGCGACAGCTGTTGGCGCTGACCTTC
        GAGACACGTCTGCTGGATTCACCCGATTATCCCGAGGACGTCAAGAAGCGCGCCTGTGCCATTTTGAACGGCTGCCAGGG
        TCAATCGGTGGGCTCGTACACCGACTCCGCCGGTCTGGAGGTGGTGCGTCGCCAGGTTGCTCAGTACATCGAGAAAAGGG
        ATGGCGGCATCGCCTCCAATTGGCAGGACATCTATCTAACCGGCGGTGCCTCTCCCGGCATCAAGAGCATTCTCTCCATG
        ATCAACGCCGAGGTGGGATGCAAGGCGCCTGGTGTCATGGTGCCCATTCCGCAGTACCCACTGTACTCGGCCACCATCTC
        CGAATACGGCATGACCAAGGTGGATTACTATCTGGAGGAGGAGACCGGTTGGAGCCTGGACAGGAAGGAGCTGCAACGGT
        CCTACGATGAGGCGAAGAAGGTCTGCAATCCGCGTGCCCTGGTCGTGATCAATCCGGGCAATCCCACCGGACAGGTACTG
        ACCCGCGAGAACATCGAGGAGATCATTAAGTTCGCACACGATAACAAGGTGCTGGTGCTGGCCGATGAGGTGTACCAGGA
        CAATGTCTACGACAAGAACTCCAAGTTCTGGTCGTTCAAGAAGGTGGCCTACGAAATGGGCGACCCCTATCGTAATCTGG
        AAATGGTCAGTTTCCTGTCCACCTCGAAGGGCTATCTGGGCGAGTGCGGCATTCGCGGCGGTTACATGGAGGTTCTCAAT
        CTTGATCCCAAGGTCAAGGCCATGCTGACCAAGTCGATAACGGCGGCGCTTTGCAGCACCACCGCTGGCCAGGTGGCCGT
        GAGTGCCCTGGTCAATCCACCGCAGCCCGGAGAGCCATCATACGATCTGTACAAGAAGGAGCGCGATGGCATTCTGGCCG
        CTCTAAAAGAACGGGCCGAGCTCGTCCACAAGGCACTGAACAGCTTCGAAGGCTACAAGGTTAACCCCGTACAGGGCGCC
        ATGTACGTCTTTCCACAGATCGAGATCCCGCCCAAGGCGATCGAGGCGGCCAAGGCCAAGGGCATGGCCCCCGATGTTTT
        CTACGCATTTGAGCTGCTCGAGACGAGCGGCATTTGCATTGTTCCTGGCAGTGGATTTGGTCAGAAGCCCGGCACGTGGC
        ATTTCCGAAGCACGATCCTCCCGCAAACGGACAAGCTGAAGCTGATGATGGAGAAGTTCCGTGTGTTCCACGCCGAGTTC
        ATGAAGAAGTACAAGTAGATCAGCTGCCAACTTCCCCGTCCTCGATCCCTGTGTTAAGTGTCAATCCTCCGGCTTAGGAT
        TAAAAATTTAAATTACCCTAATTGTTTTTTTTTTTTCCTCTTTGTTACTGTGTCATAGCTGAATGCTTCTAAGCTCTTCT
        TTATATGCATATATAGATATATATGAGAAATATATAAAAACATTTTTAAAACCCTATGATTTGTGAACCCAACCCGCGCA
        GGTTTTATCGCCACGATAACGTTTCCAGTTAGCAATTAACCCACTTAACCATGTAGTCTTTGATTCTTAATTGAACGAAA
        ACTCCTGGCGGAGATTTGACAATAATTTTTGTTAGAACCAAAAGTAGTTTACCATCTTTTGGTCGGCGCATAATTGAAAA
        TTCTGATATTGTTCTAAACGAAAGTTATTTGCATTGTGTATATTTATATTTATCTACACATAAATATATATAGCCCTGCA
        TGTGCTTATCCCCCGCGAATCGATCACGAAAATCATATGATGTGTGTGCGTTCAAGTCATTACTAATTGTTATAGACAAG
        AAGAAACTTTGAAAATAAATAAATAATTATTATTGTT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0073773
        2664
        FBtr0073769
        2488
        FBtr0073770
        2558
        FBtr0073771
        2511
        FBtr0073774
        2823
        FBtr0339837
        2329
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0073603
        568
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0073604
        568
        FBpp0073600
        575
        FBpp0073601
        568
        FBpp0073602
        568
        FBpp0073605
        568
        FBpp0308869
        568
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG1640-RE
        Secondary FlyBase IDs
          References (2)