Open Close
General Information
Symbol
Dmel\RpS15Aa-RA
Species
D. melanogaster
Annotation Symbol
CG2033-RA
FlyBase ID
FBtr0073793
Feature type
Associated gene
Evidence Rank
Length (nt)
678
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 153 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        Sequence
        CCCTTTCTTTTCCCTTTTTCACGTTTGCGTGAGTACCGGTCGTGTAAAACAGTTTTTGCAAACAAATCCAGCCATGGTGC
        GTATGAACGTATTGGCCGATGCCTTGAAGTGCATAAACAACGCCGAGAAGCGTGGCAAGCGGCAGGTGCTGCTGCGTCCC
        TGCTCCAAGGTGATCATCAAGTTCCTGACCGTGATGATGAAGCATGGCTATATCGGCGAATTCGAGATCGTCGACGATCA
        TCGTTCCGGCAAGATCGTTGTCAACCTGACCGGTAGGCTAAACAAGTGCGGCGTCATCTCGCCCCGCTTCGATGTGCCCA
        TCAACGACATCGAGAAATGGACCAACAATCTGTTGCCCTCGCGTCAGTTTGGTTACGTTGTGCTCACCACCTCTGGCGGC
        ATCATGGACCACGAGGAGGCTAGGAGAAAACATTTGGGAGGCAAAATTCTCGGCTTCTTCTTCTAGAGAAACCAAGTTCG
        CATCGTAGAGAGTCTGTATGTGCTGCTAAGGAGTTTGATATGTAGATTGACGTTTTATTTCACCGACCATGCAACCAACT
        ATGTACTTTGTGCACAGGAAACAAGGGGCGAAAACGCTGCTACGTTCATTCAGAAAACAAACGACGATGAATGTTCACAA
        AGTTACGCGAAATAAAATGATTGATACATAATAATTTT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0073792
        737
        FBtr0073794
        877
        FBtr0073795
        741
        FBtr0300828
        674
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0073624
        130
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0073623
        130
        FBpp0073625
        130
        FBpp0073626
        130
        FBpp0290052
        130
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (3)
        Reported As
        Symbol Synonym
        CG2033-RA
        RpS15A-RA
        RpS15Aa-RA
        Secondary FlyBase IDs
          References (2)