Open Close
General Information
Symbol
Dmel\CG11151-RA
Species
D. melanogaster
Annotation Symbol
CG11151-RA
FlyBase ID
FBtr0073819
Feature type
Associated gene
Evidence Rank
Length (nt)
705
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 84 )
Sequence
AACTTGCTATACGACCATCCCGCTCCCACACAACAGGGGCAGTGTAGTGAAAAAAGCGACAATAAAATCGCCGATTGCAC
GCCTTCTGCTCATTACTTCGCGTTCCGCTCTCAAAGCAAATACCCCCACAACAACAACAACAACAACCATGTCTCTGCAG
TCGGACGCCGTTTTCCAAAAGATCATCGATGGACTGAAGGAGAACGAGGCCAAGGCCAAGGCGGTCAACGGTGTGTTCCT
GTACAAAATCACCAAGGACGGCAAGGTGGCCAAGGAGTGGACTCTGGACTGCAAGAACGCCAAGGCCTACGAGGGACCTG
CCCAGGGCATCAAGGTGGACACCACCTTGACGGTCGCCGACGAGGACATGGTTGACATCGCCCTGGGCAAGCTGAACCCC
CAGGCTGCCTTCATGAAGGGCAAGCTGAAGATCGCCGGCAACATCATGCTCACCCAGAAGCTGGCGCCGCTCCTGAAGAC
CGACGCCAAGTTGTAAAAAAGGAGTGATCAACAATAACCCAGCCCAGTTAGCACATTCCTCAACGAGACAGTGTGTGTGT
GTTCCCTTTTACACAATTTTTTTTTTTTTTCGTGTGTGTAATTTGTAATCTGTATTCGTGTTTTTGTTTCACCACATAAT
TAATGTTATTTTTGTACGGAAAAACCCGTCTACAAAACTAGAAAATAATACATAAGGCGAAAACG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0331719
1066
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0073650
115
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0304108
115
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG11151-RA
Secondary FlyBase IDs
    References (2)