Open Close
General Information
Symbol
Dmel\be-RC
Species
D. melanogaster
Annotation Symbol
CG32594-RC
FlyBase ID
FBtr0073957
Feature type
Associated gene
Evidence Rank
Length (nt)
3240
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 41 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTAGAGCTAAACGAACTGCCATCCGGTAAACACGTCTCACAACGTTATTTGTGTTGAATATATATATATTTTTTTGTTGT
        GGCTCTTTTTTTTTAATTTCTGCGGCCCCTAAAGTTCGACGATCGTGAGAAGGGAAAAAGAGTGTGAAGTGACCTAAGCG
        GTTTTGAAATATCTATCTTGGCAAAACGAAAACAAATTTGTTAAAGCACATATAAACAAAAACAAAATAACAAAAATAAA
        AGTGAAGCAAAGGTGAAGAAGACCAGAATGAATTCGCGACGGATTGCTCTGGTCCTCCTAATCGGCATAATCGTTTCGTT
        TTCTGGCCATGATGCACTAACCTATCCGGAGCGCTTCGATCGCCTGCCCACTTGGGGTGGTCATTCCCAAATTGGTGGGC
        CGCTGCTGGATACCGCCCACCGGGAGAATCGTGAGAAAAGGGAGAATAGGGTGGACCTGTGCCGGCACTGTTTCTGCATT
        CATCTCAAGGCAATCTGTGATTACAAGCTTAACAAAACGCTCCCGAACGAATTTAACGATAAACTATTGGTGCCGCTGAA
        CATCAAATATATTGAGGTGCGACTGACTGTTGGCACCCAGTTCGTGATGTACGAGAACTTCTTCCAGGACAACCAGGTGA
        ACTACTTTGGTGTAATCGGAGTGGGGAAAGATGACCAGGTGGAAATAACCAGCAATGCATTTAGCCACAACAAAGGCGGT
        TTTCCCAACATCGAAATACGAAATGTATTGCGAGTTTTTCTGCGTGAGAAATTCCTGACCGGTGCGGACTACAAGCTGCT
        GGTGGAGGATGTTACTCAGCTGTCCGTATTCTCCAATGCCCTTCAGATGACTAATCTAGACTGTTCTCTCAAGCGGATCA
        AGGAGCTGAATCTGATGAAGAACGCTTTCAATCCTGGGGTTGCCAAATATGGAATAAATCTCCGCATCGAGGATTCGAAC
        ATCAATCAGCTGGGTATATTCGGCGTGTCCATGGGCAAGGTGAGCCTGTTGCGCTGCCACATCGACATGATCATGAGCAA
        CGCCTTTGACGTTACCAGCATCAAGGAGCTGATTATCGAGGGCTGCAATATCGAGGTGATCGAGAGCCAGGCGCTAACCA
        ACAAATTGCATAGCGATAAGGTGGCCATCGTGGATACGGTGATCGGTACGATTGAGGGTCAGGCGATCAGTCAGAGCGGT
        ATAACTACCATGATTATGTTTGGAAATACAATTACAAAAATACGTTCGAATGCCATTCAAATTGTTGCCGTTAGTCTGTT
        CATACGCAACAATTCAATGAGCCATGTGGAGCCCAATTGGTTGAGTGTCAGCCAGGCCGATCAAGTGGAGATTGCGAATA
        ATCGCTTCGAGGACTACGGACGCTGTGAACTGAACATTGGCTCCTCGAACTGCAGTTTTCGCAACAATATACTGCAGAAT
        CCGCAATCGGGTAGCCTCAATTTTACATGTCGCGTCCACCAGGTGCGCGTGGGCACCGAGTGCTCGTGCAACAAGTCCTG
        GCTATCGGAGCTAACCGATCATGATCTGGAATCGGAAATCATGTGTCAGGTGGCAAAGCGTGATGCCAACTGCTTTAATG
        CCACCAATACGGATGTCCGCCGGTATGTCAACGAGGCATGTGGCAGCAATGTGACCCGCTACTGTATGGGTGGCCAGTGG
        GTGACCAAGGCGGTCAGTGATCATTCTAGCGACTCCAGCAAATTGACCATCGGAATGATAGCCCTTGAGATTGTGATTTT
        AACACTCTTGCTTGTTGCGATTGTCTGTGTGTTGGCCAAAAACTGTGGCAGTGGAAGCTGCGCTCCTGCCGGTGGCCAGT
        CCACTGATAATTGCCTAATCGAGGAGGACATTCGCAACTCACTGCGCCAGCTCGCACTGCACAGCGAGAGCAATAAGACA
        CGCAAGGCTATACTGAAGCTGATCAATGGTCATTTGAGCAAGGGGGAGTGCAACGATCGGATACTCTTTATAGTGGACAA
        CATGCCGCAAAATCAGGCGATCGAAAGCCTGCTGTTTAGGCACATATCGCAGAGTCACATGGAGCCCAGTGATAGTGAGG
        CATATGCCAGCACCGCCTTAACAGCCAATGCAACAGCACCACCACTGCCGCCCAGTACCGATTCCAGTGAGCCCATCTAC
        CAAGAGCTCGACCAGCAACGACTGATCATCGACGACAAGTACTCATTGCCGCTGAATTCCGACGAGGATCCGCCGTACTC
        GGAGCCGTCCAATATGATGAATACGAACGACATGCCACCGGCATATCAATATGCCACACCGATGCGCATCCTGCCATGCC
        ACCAGATGCAGCATCAGCAGCCGTCGACGACGGCCAATTATGCCATCCCCGTTTGGAGGTCCACTCCAAGTGCCACGCCC
        ACTAGCCGCCCACCCTCGGGCTCACAGGAGGGGTCGGCCACCGCCACAGCGCCCAGAGCTGTCAAGGATTTGCGGCAGGC
        TCTGCAGAACTCCCCACAGTTCCATCCCAACCAGCTGACCTCAACGCGCAACCAAAGACAAATCCTGCAGATTCTGCCGC
        CGCTTCAGCCGCCGCCGTACACTCAGAGGTCACAGGTCAGGGGTCAGCGGAGGCGCAGCTTCGAGTGCCTCGATGGCGCC
        GCCAGCTTGGCGGCCATGGAGCACATGGACTCCGGCTCGGATCACTCTGGCGGCAGTGATGTGACCGTCCAAATTGCTGA
        TGTGATCGACTACGCGGATGCCTAAAAGTATGCAGAGCACTCAAATATATACTATACTATATATATATAGTACAGTATAT
        ATATATATATATATATACCTATGAATCTGCCACAATCTGTCACACCTGCCAGCCACAAAAAAGAGTATAAGATGAGTGAA
        TGATTAGAGAGAAACAAAAAATACCGAAAACACAATGTGATATTCTCTGGATATGCGATGAACTGAGGAGACCTACGCAT
        ATACCTAATTAGCTAGGGAGAAGCGAACTAGGAGATATAAACCATAAGCTAGATTAAGTGAATTAAATTTAAATAAATAG
        CCCGATCGACCAAGTGCCTGCAGATATAATATATGTCGGGGCTTAAATGGAAAGGTACGTCATATCTTTATCGACAGAGT
        TTTCATATAACTCTGCGCCCCAATTATATTGTATTTTGTATTCTAAACCAGAACATGATACATTGTTCATGATATGTGTC
        AATAAACAGATCACATTTTAAGTAGATGTACCAAGAATGT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0073956
        4014
        FBtr0310270
        3069
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0073774
        825
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0073773
        700
        FBpp0301953
        825
        Comments

        Transposon inserted in intron

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (3)
        Reported As
        Symbol Synonym
        CG32594-RA
        CG32594-RC
        be-RC
        Secondary FlyBase IDs
          References (2)