Open Close
General Information
Symbol
Dmel\CG15814-RC
Species
D. melanogaster
Annotation Symbol
CG15814-RC
FlyBase ID
FBtr0074470
Feature type
Associated gene
Evidence Rank
Length (nt)
1740
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 9 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CGTTGGCCTCGAACGTTTCGTTTTCGATAATCAGAAAGCGCTGTCGTAGCTAAAGTAAATAAAGGTTATGATAAAATAGC
        AACAATTTGGGAAAAACCCCATACTCAGGACAGCTGGTTCTAACAATCAGGTAAAAACCGATCGCAATACGTGGTGGGCA
        AGATAACGCAGCGACGCAGACGACGAGTGGGACTGTCCGGCGGATTGGCGGCAGCGGGATACGGCGGATACAACGGCAAT
        AAGATGCACCAGGAGCACATGGACCTGCATGAGCCCGTGGACTTGAACAAGTCCCTGGACGAAATGACGCCGGAGGAGCG
        AATGCGAGCGCAGCATCAACTGATGGTGGAGAAACATCGCGGCCACGATGCCATGCACTCCGAGATGGTGATCATTCTGT
        TCGTCACCCTGGTTATTGCCCAGATCATCCTGGTCGAGTGGAAGAAGCGGCACTACAGATCCTACGCTTTCGTCACCCTG
        CTGGCCATGTGGCTCATTCCGCTGATCATCTCCTGCAGCTTCGGCTGGCTGCGCTTCATAATCATCTGGCTGGTGTTCAC
        CTGCATCACGGCACTGGTTATGCGACGGGCCATCAGCAAGCCCATCCAGGGCACAACGCCTAGGCTGGTCTACAAGTGGT
        TCTACTTCATCTACAAGCTCAGCTATGGCCTTGGCCTGGTGGGCTATCTGGTGATCATAGCCGCCTTTCTGGGCATGAAT
        TACATGTTCTCACAGCCACCAAACACATGGATGGATGTGGGCCTGATGTTCTGCTTCTACGGCCTGTACATCGGCGTCCT
        GGGGCGTGATATATCCGAGATATGTTCGGATAAGATGGCGGCAGCTATTGGCTACTACACACCTCAGGGTATTCCAACAC
        GACATCTTGATCAGAATGTCTGCGCAGTGTGTGGCAATCAGTTGCTGGTCTCGGAGAAGGAAGAGGGCGTCATTGAGAAC
        ACCTACAAGTTGTCTTGTAACCACGTATTCCACGAGTTCTGTATACGTGGTTGGTGCATTGTGGGCAAGAAGCAGACGTG
        TCCCTACTGCAAGGAAAAGGTCGATCTCCAGAAGATGTTCCGCAATCCCTGGGAGAAGCCGCACGTTTTGTACGGTCGCC
        TGCTGGATTGGATTCGTTGGCTGGTGGCCTGGCAGCCGCTCATCTTTTTCATAGTACAAGGCATCAACTGGATGCTGGGA
        CTGGAGTAGATCCTGATACCGGCACTAGCTTTCCTCGGCGTCTAGTCAAGCACACACACTTCGGATTAAGTCCTGCACAT
        GAAACCACACGGAAAACACGACGATGGAGAAACAACGACAGACCAACCTGGAGGGGCTGCGAAACACCCGCACCACTAGT
        ACCGTCGCCGTTCATTCCCCCGCTCCCCTCCACGACTCCATTACATGAACCTGAACCATGATGACGATGACGGATGAAAG
        ATCTGTAGACGAATGCCATTGCCATCCAATCTGTTTGCGGGTTTCCAGTTCTGTGTGTGGTTTGCTTTTGGGCACCCAAA
        TTTTCCTTTTCCATTGGAGTCTTTAATCGAAACGTAAATGCAATTTTGGATATATGTATCTATATCTATATATTATACGT
        AGCTATGTATTTATGTACATATGTGTGCCTGTGTGTATGCCTCCTAGGTATTATTACCAATTTTATTTTCTTGATTTTAC
        TTAATTGCACTCGAGCTGGTTAGGAATATACATATACCAAAAAAAATCTATTGATAAAAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0074469
        1884
        FBtr0074468
        1664
        FBtr0074471
        1487
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0074244
        321
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0074243
        321
        FBpp0074242
        321
        FBpp0074245
        301
        Comments

        Only one EST supports this alternative transcript

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG15814-RC
        Secondary FlyBase IDs
          References (2)