Open Close
General Information
Symbol
Dmel\Pfrx-RB
Species
D. melanogaster
Annotation Symbol
CG3400-RB
FlyBase ID
FBtr0074717
Feature type
Associated gene
Evidence Rank
Length (nt)
3376
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 67 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CGACGTGTACGGAACTGAACTGAACCGAACTGAATTGATACGCGGTTCGGCGGATTCGCTTTGTACTTTCGTTTCTTGTG
      CTGTTCTGTGTGCTGTGCGCCCCCACATCAATATCGAGTCAAAATCAAGTCAAAATACGAGAATTCGTGTGTTTTTTCTC
      TGTTCTTTTTTTTTAACTATTTTGTTTTTTTTTTATTATTTGCGTACTAAGAAATTAGCGTTGTAGCAAAAGTAATCTGT
      GATTTTTTTTTCCGTTCTGTTTTGTTTACCTTTGGCTTGTAACGATTCAAAACAAATAGCAAATCGCGTGATTAAGTGAT
      AAAGTGGCCAGAAGTCGGTGGTCGGGCGCTCTGCACACTGCTTGCATTCAGCGCGCGCCTGCACTGCTTGCATTCCAGGG
      CAATGGCTCAGTCGACGGCAACGGCGCCGCTCTACGCCGGCTACAAACCCCTGATCAGCTCGGTAACCACGGATACGGAT
      CCGGATCCGGATATGGCCCCCTCCCTGTCAGCAGAAGGAACAGCTGATCAGCCCCAAAAATCACAGAGAGAAGGCGAAGT
      GAAAGGAGCATCATCAGAAGCCCAACGAACAAAAGCAAACCCAAACCAGATACTTTCAGCCAGCAACAGCAGCTCAATCG
      ACGAGCAAGACGAGGATCAAGTAGGAACATTGCCATTGCCCCTGCTGTCCATCAATAGAAGGACACCCACCCTGCTCCCC
      CGCCCCGTTCCACCATCATCGACCCGATTCACATCGTCCTACAACGACGACCTGTGCACGTGCAGCAACTGCGCGTACTC
      CAGTTTCTCATCCTCCTCCTCCTCCGCCTCGTCCACATCCTCGTCATCCACGAGCGCTACAGCAGCAGGAACAGCATTAG
      CATCAGCAGCCGCATCCGCCGTTGCCAAGAAGCTAGCACGCTCCGTGACCGCCACCAGCATCATGGACATGCCGTACAAC
      ACCTCGCCGTCGCTACGCGTGCGCACCACCTCGCTGAATCAGCTGAAGAAGACCGCCGACCTGGCCATCGAGAATGAGCT
      GCACGTCTGTCCGTCGGTGATGTCCGAGGAGCTGCGCAAGCTGCTGCCGCCCACCTCGGAGACCGTGATGACCAAACCCT
      TCCCCATCCGGGGCGAACGGACCATTGCCGACTGTACCACGCCGCATGTGATCGCCATGGTTGGCCTGCCGGCGCGCGGC
      AAGACCTTTATCTCCAAGAAGCTAGCGCGCTACCTCAACTGGATCGGAATCTCCACGCGTGTTTTCAATCTGGGCGAGTA
      CAGGCGTCATGCAACCACAGCATACAAGTCGCACGAGTTCTTCCGCGCCGACAACGAGGAGGCGATGGCCATCCGCAACC
      GGTGCGCCAATCAGGCGCTGCACGACTCGTGCGATTGGCTGCTGAGCGGCCAGGGAAGCATCGCCGTGTTCGATGCTACC
      AACTCTACGCGCGACCGTCGCCAGCTGATCCACGACATTGTCGTGAAGCAGCATGGTTTCCGCCTGTTCTTCGTCGAGTC
      CATTTGCGACGATCCGCAGATTATCGAGCAGAATATTCTGGAGGTAAAGGTCAGCTCACCAGATTACCTTAACATGAACA
      CGGAGCTGGTGGTGCGGGACTTCCTGCAGCGCATCGAGCACTACGAAGAGCGCTACCAGCCCATCGACGAGGTTACCGAG
      TCGCACCTCAGCTTCATGAAGGTGTACAACGCCGGCAAGAAGGTGGTCGTCTACAATAACGAGGGTCACGTGGAGTCGCG
      CATTGTCTACTACCTGATGAACATCCACATTACGCCGCGCACCATCTACCTGACGCGTCACGGCGAGAGCGAGTACAACC
      TGAGCGGGCTCATCGGCGGCGACTCGAACCTGAGCGCCCGTGGCCACCAGTATGCCAATGCGCTATCCACTTTCATCGCC
      CAGCAGCAGATCGACGGTCTGCGCGTGTGGACGTCATGGATGAAGCGTGCCATTCAGACGGTGGCCGATGTGAAGGCGCC
      GCAGGAGCGCTGGAAGGCGTTAAACGAGATCGATGCCGGTCATTGCGAGGAAATGACGTACGAGCAAATCAAGGAGAAGT
      TCCCCGAGGAATTCAAGGCTCGCGACGTTAACAAGTTCGCCTATCGCTATCCGCGCGGCGAGAGCTACGAGGATCTTGTG
      GCTCGACTGGAGCCGGTCATCATGGAGCTGGAGCGACAGGGCAATGTGCTGGTTGTTTCGCACCAGGCGGTGCTGCGCTG
      CCTCTTTGCCTACTTCCTGGACAAGTCCGCCGACGAGCTGCCCTACCTGTATGTGCCGCTGCACACGGTCATCAAGCTGA
      CGCCGGTGGCCTACGGCTGCAAGGTGGAGCACATCAAGTTGCCCATCGATGCGGTGGACACGCATCGTCCCAAGCCTAAG
      ATTCCCGGCGACGTCAGTGAGCCAGGACTGGATGGCCTCAGCGGCGAGCTGGTGGCACCCGATGGCGTCGGCAAGGTGCT
      CATTGTGGGTGACGATGTGGCGACGGCCACGAACGGCAATGGCGGGCGCGTCGATGTCCAGGCGCACCAATGACGGCGTC
      GCCTGCACCCCGTGCATCCACATCCACCTCCGAAATCCAAGACAATCTAAGCACGGCTGCTGGAACGGCTACGGCTGCCC
      CAACCTCCAAGACACTTGCCCGCCAACCCCGCCCCCCCAAATCCCAGAACAGATCCCGCACTAATTCTTCCCCCAGCGCA
      TCCCGGACAGCCCAACTGAAACGGACAAAGACACGGACGTGGTCATGCGAGGGCAACACTGACAACTGCTCCTGCACCTG
      CTCCAAGGATGTGGTGGCATCTCTACTTAACGTGGCGTCGAAGGACTGCGTATGAAATTGTGATTGATCCATTGTGCTGT
      TTTATTATGTACTTTAATGAACGATTAAATATTTTTAAAATTTTCTAGAACATCTATATACTTTGATAAAAGCAAAATAC
      AGACTTAAACACCTATCTAGATTTACACAATACACACCTTCTCCTGTAAATGGAGAAGTCCTGGCTTGATTGATTCAATG
      TGATTAGTTACCCCTGGCTTCACATGCAGGCGGTTGGCATACCGCATGCTGAGTGCTCCAGCCACTAAAAACTTGATTGA
      TTCTAACGCTGTATACTTAAATGTGCTCTAATCTAATTCGTTGTCTATTTTTTATAACCGTTTTGAGCGAATTTTATAGC
      TAAGCGAGAGGATAAACTCACGGATTCCATTTGCCAACTCTGTTTAACTGAAACCACTTGCCCGACACACTTTTTAGCCT
      ATGTATATGTTGCTTGTAAATGTATGTGTGGAATAAATATTGTAACTACAATACATAAATACTATTTCAAATAATCAACA
      ATAAATACAATTTATC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0074714
      2981
      FBtr0074719
      2983
      FBtr0074720
      3193
      FBtr0074713
      2912
      FBtr0074716
      2928
      FBtr0074718
      2980
      FBtr0074715
      2978
      FBtr0307192
      3061
      FBtr0307193
      3197
      FBtr0307194
      3383
      FBtr0339439
      3031
      FBtr0339440
      3373
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0074486
      716
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0074483
      536
      FBpp0074488
      536
      FBpp0074489
      536
      FBpp0074482
      536
      FBpp0074485
      716
      FBpp0074487
      536
      FBpp0074484
      536
      FBpp0298021
      536
      FBpp0298022
      536
      FBpp0298023
      536
      FBpp0308526
      536
      FBpp0308527
      715
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (2)