Open Close
General Information
Symbol
Dmel\Pmp70-RA
Species
D. melanogaster
Annotation Symbol
CG12703-RA
FlyBase ID
FBtr0074795
Feature type
Associated gene
Evidence Rank
Length (nt)
2975
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 54 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CGCACATTGTCGTGGTAGCCAACACTAGCGCACATCGCACTACAGTTAGTTGCCTGCTGGCTTTTGCGCGTCGCACGTAT
      CACTTCGTCAGATTTCTCGATTTGGTCGAGCTGAGTAGAGTGTAATTACCAAACAAAGAAATGCGCCTGGCTCAAATTGA
      ATAAATAAAAGCGCCCGCCGTGTGTGACAATCACTTTGCCCACCCCCTTTGGCCAGAAAAGGAGCGCCACTAGCAGCGGA
      GGAAGAAGCAGCAGCACCATCACCACCACCAGTTGTAGTACAGGAAGAAGAAGAAGCAGTTGCCCTGAAAGAGAGAGAGG
      GTGCGAGCGAGAGAGGACGAAGCTAAGACAGGGCTGTTCGACAACCAGTGCGAACGCGAAATTGCGAATTGTAAAATTCA
      CAAGGTGCCCAATTTGAAGCCAAACGAGATCCGTAGCCACATCGCAATAGCAGAATGGCCCCGGCTCTAAGCAAATTGGC
      CAACAACCAGAGCGCCATCGTCGGCGTGGCGGGCATGACGGCGGCCCTCTGGATAATTGCCTACGGAAAGATGTCCAACA
      AGAAGCGAAAACCCGGCTATGAGGACAAGATCCAGTACACAATTGCCGAGAAGAAGGATAAGAAGGCGGGAAAGGCGCAC
      GTTAACTCAGTATTCTTCAAACAGCTCCGCCAGCTACTCCCCATCCTCATTCCCGGCTTCTGGAGCGTGGAGACCGGACT
      GCTCTTCCTGGTGGCCGCCGCACTGATTGGCCGCTCGGTGAGCGACATCTGGATGATCCAGAACGCGACGGTGGTGGAGA
      GCACCATCATACACATGAATCGCACCAAGTTCAAGACGGCGCTGCTCAAATACCTGACAGCTCTGCCAGCGATCTCCGTT
      GTGACCAACGTCCTCAAGTGGAGCTTGGGTGAGTTGAAGCTGAGGTTCCGCACCAACCTCACACACCACCTGTACAGTCA
      GTACCTAAACGGCTACACGTACTACAAAATGTCCAATCTGGACAATAGGATAGCCAACGCCGACCAGCTGCTGACCACGG
      ACATCGACAAGTTCTGCGAGAGCGCCACGGACCTCTACTCCAACATCAGCAAGCCCGTGCTGGACATCTTCATCTACGTG
      TACCGCCTGACGGTGAACCTGGGCGGCAAGACACCATCGATCCTGATGCTCTACCTGCTCTTCGCCGGCGTCTTCCTGAC
      ACGCCTGCGCCGCCCCACTGGTCGCCTGACCGTCGAGGAGCAGAAGCTGGAGGGCGAGTTCCGCTATGTGAACAGCCGAC
      TGATCACCAACTCGGAGGAGGTGGCCTTCTACCAGGGCAATGTGCGCGAGAAGCTCACCCTGCTGGCCAGCTACTCCAAG
      CTGCGTTCGCATCTGCGCAAGTTCCTCGAGTTCCGCGTCAGCATGGGCATCATCGACAACATTATCGGCAAATATTTCGC
      CTCCATTGTGGGCTTCTACGCCGTCTCCATTCCCTTCTTCTCCGAAAACCATCCGCTGCTGTCCGGTGAGAATAGCGGCC
      AGCGCCTGCAGGCCTACTACACCTACGGACGCATGCTGGTCAAGCTGGCGGAGGCCATCGGACGCCTGGTGCTCGCTGGA
      CGTGAGATGTCCCGCCTGGCCGGCTTCACCGCCCGCATGACCGAGCTAATTAAGGTTCTGAGCGACCTCAACAAGGGCAC
      CTACGAACGCACCATGGTGAACGGCAACAACCTTGCGCAAAACGCCGTCGGATCGGCGTCAAGCAACTTTGGACCAAACA
      AGGGCATCATGTGCTTCGAGGACAACATTATCCGCTTCGAAAAGGTGCCACTGGTGACGCCCAACGGCGATGTACTGCTG
      CAGGAGCTGTCTTTTGAAGTGAAGTCTGGCACAAACGTCCTGGTCTGCGGTCCCAACGGCTGTGGCAAGTCCTCCCTGTT
      TCGCATCCTCGGTGAGCTGTGGCCGACGTGGGGCGGCAAAGTGACGAAACCGTCGCGCGGCAAGCTTTTCTACGTACCTC
      AGAGGCCCTACATGACGCTGGGAACACTGCGTGACCAGATCATTTATCCACACACGCGCGATGACATGCGTCGCCTGGGA
      CATAGCGACGAGGATCTCATGCACTACCTGGACATTGTGCAGCTGACCTACCTGGAGCAGCGCGAGAACGGCCTGGACTC
      CATTGAGGACTGGATCGACGTGCTGTCCGGCGGCGAGAAGCAGCGCATTGCGATGGCTAGGCTATTCTATCACAAGCCGC
      AGTTCGCCATTTTGGACGAGTGCACCAGTGCCGTCTCCGTTGATGTGGAGGGCAAGATGTACAGCTATTGCCGCGAGGTG
      GGCATCACGCTGTTTACGGTCTCGCACCGCAAGTCGCTGTGGGCGCACCACGACTACTACCTCCAGTTCGATGGCCGGGG
      CAGCTACGAGTTTGCGACCATCGATCAGGATAAGGACCACTTCGGTTCCTAAAACTAGCAATTTCCATTCTTCAAGCCCA
      AGCCCGATGATGATCATACCGCTCTGGCTTCTCCTCCTCCTCCTCCTCCTCCTCCATGCGGTGCACTGTATATACCGAGA
      TTGTATATATTGCAAGTTGGAAATGCTTCCTTGTTTCGATTGTGATTGTTTCTTTTGTACGCTATTCCACACTATATTCC
      GTTTTATATAATTCCCTCGCTGGGATTTAAGATGTGTAACTCTGAGAATCGAGCTGGTGTTAGTGATGTAAGCGTAAAGT
      AGTCGGCGCACAGCCACAAGCGATGGATGAGCGTTTAGAAAAGCTTTTAGTGAATAACACACCCATACCTGTAGTAGACC
      TGCATACCGCACAAGTCCCAAATCGCGCATAGAGAACTTATAGTAATTTGTAAAATACGCTTGGCTTATTCAAATGTTTT
      GTATTTTTGGTTGAATTGGAATTGGAATGGAACCTTGCACGGCAATAATGTATTGCATTATACAGTGCAAGACGCAATAA
      ATGTATATAAATATG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0335155
      2728
      FBtr0335156
      2882
      FBtr0335157
      3185
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0074564
      665
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0307154
      665
      FBpp0307155
      641
      FBpp0307156
      665
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG12703-RA
      Pmp70-RA
      Secondary FlyBase IDs
        References (2)