Open Close
General Information
Symbol
Dmel\Oatp74D-RA
Species
D. melanogaster
Annotation Symbol
CG7571-RA
FlyBase ID
FBtr0075173
Feature type
Associated gene
Evidence Rank
Length (nt)
3704
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TGCGTATTCGTATTCGAATTGTTACCGTGTGCGGACTGTGCCGACGGGCAGCGGAACTCAGGCGGTGCAACTTGAGTGCT
        TGATAAATTTGTTGTATTGAAACCCAACCGCAAATACAATTTTCAATTGGCTGAGTGCGTGTCTTCAACGCACAAACATA
        CGAATATAGCATTTAATATTGTTCATTATGTGTGCAATTAAATAAAAAAAATTGTGTGTGAAATAACAGAAAAACGAGTG
        CGGCGAACAGAGGCAGCAACAAATTAAACGCGTAAATTGCGTAGCAAATTCTGAATGAAAAAATTCAACAAAACCAGAAA
        GCGAAACAGGAGCGATAAGCTTACCAACTAAAGAAACTCACGCCTAACAGAAATACACACCACTGCCATATTAAAGCAAA
        GAATATAGAACTGTTTTACAGACCAGATCAACCAATCTACCTCGACTTCTGGGCCAACAAGCAAAATAAAACTAAACTCA
        ATGCCAGAACCCAATTTCCCGATAGGAAAATGGAACAGGCAATAAGCAAGACCACATAGAGGAGATTAACTAAACGGATC
        CGTTGAGATTACACAGTTGAGATCAATAAAACCCATTGAAGATCGATCAAACCATCTAGTTTTTTAGAGTTCCATTAGAA
        GCCAAAATGACGAAGAGCAATGGCGATGTGGAGGCGGCAGCCCAGGTGCAATCTCTGGGCGGAAAGCCCAGCAACGGACA
        TGGCCAGCTGAATGGGAATGGCTATCATCAGAACGGCGGACGCAGGGATTCCAGTCAAGCCTTCACACCACTGCTGTCGC
        AGCACAATAATGGCACCACCAATGGCGAGGTGACCACTCCGCCTCCGAGTACAGTGCTCTACGAGAGCACCCCGAGCAAT
        AATAACGAGTGGAAGGCCCCGGAGGATCTGGGACACCTGAAGAATGGCCTGGGCAACATACTGAGCAGTAATAATAATGG
        CACCGGCAATGGGCACAGTCTGAGCGAAAAGTATGCCCATGAACAGGCTCCCCTGACCGGAGGTTACAAGTTGCCACCTC
        GCTCCAGTGAGTCCGAGGAATCCGATTTCGATTCCGACCTCAATGGCGGCTCCTCCGCGGAATCCAGCTCCAGTTGCGGC
        CTTTTCGGCTGTCGGCCCAGGTGGGCCAGAAGATTCGCGTCCACGCACGTCTTCATGGTGGTCTTCCTGCTGGCCTACAT
        CCTGCAGGGCATGTACATGACCTACTTCGTCTCTGTGATCACCACCATTGAGAAGCTATTCCAGATCAAGTCGAAGACCA
        CGGGAATTCTGCTGAGCGCCAGTGAGATGGGTCAGATATGCACGGCCATGTTGCTGACCTACTTCGCCGGCAGAGGACAT
        CGTCCGAGATGGATTGCCTGCGGCATGGTCCTGTTCTCAATCGCCGCCTTCTCCTGCGCCCTGCCGCATTTCATCTTCGG
        CGAGCAGCTGATGCACTCCAGTGTAATTCTGCAGCAGACGCAGGTCTCCCCCCCCAATAATTCCTTCTCATCACACTGGC
        TGAATGCCAGCAGTGAACAGGTTAATCCCAATTTGTGCATTTTGGGTGGCAACCAAACCCATTCGGGCAGCGAGTGCAAC
        GAGGAGCGCCAGCTGGAACAGGCCTCCCACTCTAAGATCACCGTCATCGTGCTGTGCATCTTCTTTGGCAGCCTGCTCAG
        CTCGGGCATTGGCCAGACCGCCGTGGCCACACTGGGCATACCCTACATCGATGACAATGTAGGCAGCAAGCAGTCGCCCA
        TGTACATGGCCGTCACCATTGGCATGAGGATCCTGGGACCGGCATCCGGTTTCATTTTTGGCAGCTTCTGCACTCGCTGG
        TATGTCAACTTCTCGAATCCCGGCTTCGACGCCACGGATCCGCGCTGGATTGGCGCCTGGTGGCTGGGGCCTGTGGCCAT
        TGGCAGCCTCATGCTGCTGGCCTCCATCGCCATGTTCTCGTTTCCCAAGCAGTTGAGAGGCAAGCAGAAGCCGCCGGGGC
        AGACAGCAACTCCAGCAGCTCCAGTTGAGCCGGAGGAGAAGCCCAAGCTAAAAGATTTTCCCAAGACAGTCCGTCGCCAG
        CTGAGCAACGACATCCTGATGTTCCGCACCGCCTCGTGCGTGTTCCACCTGCTGCCCATCGCCGGTCTCTATACGTTCCT
        GCCCAAGTATCTGGAGACGCAGTTCCGGCTGGCCACCTATGATGCCAACATGATCGCCGCCTTCTGTGGCATCCTGGTCA
        TGGGCATAGGTATTGTCATTTCCGGGCTCTTCATCCTGAAGCGAAAGCCCACTGCCAGGGGCGTGGCCGCCTGGATCGCC
        TTTACAGCCCTCGTCTACTCGGCGGGCATGATCATCCTGATGTTCATCGGCTGCAGCATGAACGACTTTGCCGGCTACAA
        GCCAAGCGATGGCAACAGTCCCGCCTTGATCGAGCCCACGTGCAGTGCCGCTCTCAACTGTACCTGTGATAAGGAGAACT
        TCGCGCCCATCTGCGCCGACGGCAAAATGTACATCTCGGCCTGCCACGCCGGATGCAGCAGCTCCTCACTGCGGCCCAGC
        GACAATCGCACACTCTACTCCGATTGTGCTTGCATTCCAGATGCTCCGGAGGCGGTCAACGGTTACTGTGATAATAACTG
        CAAGAACTTCATCTACTTTATACTGATCTTTGCCATTTGCGTATTTATGCATTCCACCTCCGAGGTGGGCAGCATGCTGC
        TCGTCATGCGCTGCACACACCCCAAAGATAAGGCCATGGCCATGGGTGTGATACAGTCGGCCATCGGCCTGTTCGGCAAC
        GTTCCCTGTCCCATCATCTACGGCGCAGTGGTGGACTCCGCCTGCCTCATCTGGAAGTCGGTGTGCGGCAAGCACGGCGC
        CTGTTCACTCTACGATGCGGACACTTTCCGGCAATATTTCCTAGGAATCACGGCTGGCATTATGTTCCTGGCATTCCTGA
        TGGATCTGGTGGTGTGGCGCAAGGCGCATCGCATTGACATCGCGCCCGAGGATCCGCAGGAGGGCGGGCCCGCTTCCAAC
        GGAAGGACCTTGGAGGTGTCCGAGTCCAAGCAGCCCATCACCCCGGCGCCGGACACGACGGTCTAGGAGGAGCGGGTCGG
        CGACGAGCCTTGCACAAGCTGCAGGATTTCCAATAAACGTTTACCTTAATTGTTAATTAGTTATCATTTGTCTAGTTTGT
        TAGCCTAGTGCAAGAGTTATGTATTTAGTTAAGTGGCATCTTCGAGCGTCGGGAGACCTCATTCAAATCCACATTAGAAC
        GCGCTCGTCCAGCTCCCGCTCCCGATCCTGCTCCAAATCCCAGCACCATATTCTACATGAAGCCCATGGATTGCGATTTG
        AATCCTTGTAAATCTCAACGCGAAACAATGAAATGAAATTCTAGACATTATCTAACGTCATGCATGAGCGTAGTTAATCG
        ACGAGCTAATACTACAAACTGATCGACAATTGTGCAAAGTGCAAGAAAATTTATGAATCCTTATGTGTAAACTATATGTA
        ACAGTTATATCGCGATGTATGTAATCTATAATTAATATATTAGACATACACTTACATGTATGTATGTAATTGCAACCTAT
        CTGTGGTAGTTAAATTTTAGTTAAAATTCAAATTAATTGTCTAAGTTTGTCATACAACAAATATATACGAAAAGAAATTA
        AATGGAAAACTATATACAAGTAAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0302041
        3715
        FBtr0345117
        3658
        FBtr0345118
        4063
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0074939
        819
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0291251
        819
        FBpp0311342
        819
        FBpp0311343
        819
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG7571-RA
        Oatp74D-RA
        Secondary FlyBase IDs
          References (2)