Open Close
General Information
Symbol
Dmel\Nc73EF-RA
Species
D. melanogaster
Annotation Symbol
CG11661-RA
FlyBase ID
FBtr0075266
Feature type
Associated gene
Evidence Rank
Length (nt)
4381
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 135 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CTTCAGTCGACGCGCAGCACTCAGCACGAACAAACGTTTGACGCGTATCTGCGAGATACGGATACGAGTACGACGAGTAC
        ATATATTCGTTCTATTTTGTAAAGCTACAAAATGCATAGAGCCCACACAGCCTTCAGCCTGGCCTTGTCGCCGATGGCGC
        ACAAGAACTTCGCCACATGGCTGCTCAAGAGCAGCAGCAGTCAGCAGATGGCCAAGGTAACTGCAGCGGCCGCTGTGCGC
        ACCTACAACTCCGCAGCTGCCGAACCTTTTGCCAACGGCAGCACCGCCTCCTACGTGGAGGAGATGTACAACGCCTGGCT
        TCGGGATCCCACTTCCGTGCACACCTCCTGGGACGCGTACTTCCGCAGCAACAGCTACGTTAGCCCGCCCAACTTGGCGC
        CCGTGCAGGCCAACACTCTGCCGCTGACCGCCTTCAACTTTGGAGGAGCCGTCGCCGGCGCTGCGCCCGACTCCAAGACC
        ATTGACGACCATCTGGCCGTCCAGGCCATCATCAGGAGCTACCAGATTCGAGGACATAATATTGCTCACCTCGATCCACT
        TGAAATTAATACACCAGAATTGCCTGGCAACTCCTCGACGAAATCCATTTACGCTAATTTCAGTTTTGGCGAGCAGGACA
        TGGATCGCCAGTTCAAGCTGCCCAGCACTACCTTCATCGGAGGCGATGAGGCTTCGTTGCCCCTAAAGGAAATCCTGAAC
        CGCCTGGAGAATGTCTACTGTAATAAGATTGGCGTGGAGTTCATGTTCATCAACTCTCTGGAGCAATGCAACTGGATCCG
        CAAGCGTTTTGAGACCCCCGGCGTCCTTAACTTCTCGCCCGAGGAGAAGCGTCTGATCCTGGCCCGTTTGACCCGTGCCA
        CCGGCTTTGAGGCTTTCCTGGCCAAGAAGTACTCTTCTGAGAAACGTTTCGGTCTGGAGGGTTGCGAGATCATGATCCCA
        GCCCTGAAGGAGATCATCGACGTATCAACGGAGTTGGGAGTGGAGTCGGTCATCATGGGCATGCCCCATCGTGGACGTCT
        TAACACCTTGGCCAATGTATGCCGCAAGCCCTTGAACCAGATCTTCACCCAGTTCGCTGGACTGGAGGCTGCTGATGATG
        GCTCTGGTGATGTCAAGTACCATCTCGGTACATACATCGAGCGATTGAACCGCGTTACAAACAAGAACATCCGCCTGGCT
        GTCGTGGCCAACCCGTCCCATCTGGAGGCTGTGGATCCCGTGGTGCAGGGCAAGACCCGTGCCGAGCAGTTCTACCGTGG
        CGACCAGGAGGGCAAGAAGGTTATGTCCATTTTGATCCACGGTGATGCCGCCTTCTGCGGACAGGGCGTCGTCTATGAAA
        CTATGCATCTTTCGGACCTGCCCGACTACACCACCCACGGAACTATCCATGTGGTGGCCAACAACCAGATCGGTTTCACC
        ACCGATCCCCGTTTCTCGAGGTCCTCTCCCTACTGTACGGATGTGGCTCGTGTCGTCAATGCTCCTATTTTCCACGTCAA
        CGCTGACGATCCAGAGGCCGTGATGCATGTGTGCAAGGTGGCTGCTGAGTGGCGTGCTACTTTCCACAAGGATTGTGTTA
        TTGATTTGGTCGGATACCGCCGCAATGGACACAACGAGATCGACGAGCCCATGTTCACGCAACCCTTGATGTACCAGAAG
        ATCCGCAAGCACAAGAACTGTCTCGACCTGTATGCCGACAAACTGATCGCCGAGGGCACTGTCACCGCCGAGGAGGTTAA
        GTCGGTTGCCGCTAAATACGAGAACATTTGCGAGGAGGCATTCGCTCTGGCCAAGACCGAGACCCACGTCAAGTACAAGG
        ACTGGCTCGACTCGCCCTGGTCCGGCTTTTTCGAGGGCAAAGACCCATTGAAGGTAGCGCCCACTGGAGTGAAGGAGGAG
        ACCCTCATCCACATCGGCAACCGCTTCTCGTCGCCACCACCGAACGCTGCTGAATTCGTGATTCACAAGGGTCTATTGCG
        AGTGTTGGCCGCTCGCAAGGCAATGGTGGACGAAAAGGTCGCTGATTGGGCTTTGGGAGAGGCCATGGCCTTCGGCTCTC
        TGCTGAAGGAGGGAATCCATGTGCGCCTTTCGGGACAGGATGTCGAGCGTGGTACCTTCTCGCATCGCCACCATGTGCTG
        CACCACCAGCTGGTCGACAAGGCCACTTACAACTCGCTGCAGCACATGTACCCAGATCAGGCGCCCTACTCCGTCTCCAA
        CAGCTCGCTGTCGGAGTACGCAGTGCTTGGTTTCGAGCACGGTTACTCGATGACCAATCCCAATGCCCTGGTGCTGTGGG
        AGGCTCAGTTCGGAGACTTCAGCAACACGGCCCAGTCGATCATCGATCAGTTCATCTCCAGCGGTCAGTCAAAGTGGGTG
        CGCCAATCGGGTCTGGTAATGCTCCTGCCCCACGGCATGGAAGGCATGGGCCCCGAGCACTCCTCGTGCCGCGTGGAGCG
        CTTCCTGCAAATGAGCAGTGACGATCCCGACTACTTCCCACCAGAGTCCGATGAGTTCGGAGTGCGACAGCTGCACGACA
        TTAACTGGATCGTGGCAAACTGCTCGACGCCCGCCAACTACTACCACATCCTGCGCCGACAGATCGCATTGCCTTTCCGC
        AAGCCCCTGATTCTGTGCACGCCCAAATCGCTGCTGCGTCACCCCGAGGCTAAGAGTCCTTTCAGCGAGATGAGCGAGGG
        CAGCGAGTTCCAGCGCATCATCCCCGACAACGGTCCCGCCGGCCAGAATCCCAGCAATGTGAAGAAGGTCGTCTTCTGCT
        CGGGCCGCGTCTACTACGATTTGACCAAGACACGTAGGGAAAAGCAGCTGGAGGGCGAAATCGCCATTGTGCGCGTGGAG
        CAGATCTCTCCCTTCCCCTTCGATCTGGTCAAGGAGCAGGCCAACCTGTACAAGAATGCCGAACTCGTGTGGGCCCAAGA
        GGAGCACAAGAACCAGGGCAGCTGGACCTATGTGCAACCTCGTTTCCTCACCGCCTTGAACCACAGCCGCGACGTCAGCT
        ACGTCGGACGCGCCTGCGGAGCCTCCACCGCCACCGGATCCAAGGCCCAGCACATCCGTGAGCTGAATGCGCTGCTCAAC
        GACGCGATTTCGACCTAAGGAGATGGGTCTTGATGAAGATGAGATTGGGATGAAGATGGAGATGGAGACGATGAATATTA
        ATTACGATTATATTTTGTATTGAAACGTATGCAGACTCTTTGATACGATTTTTTGCTGACGAAATTGTTAAGAGCATTGT
        GTGAAAGTAATGAAATGTTAAATATTAGTTTAGTGAAATTACAAGAGCTAACGGCAACCAAGTAACAAATAACACGAAAT
        GTTAAGTGTTTAGTAAAGAATCAAACAAAACGAAAAAGAACTACAACCACTCACAGCAAGTCTTTAATACAAACTAAAGA
        GCCAAGATCTAGTAAATAGCCAACTAACCTATGCGCATACATTTGAAGTGATGAGAACTCGCATAGGAGGAGGATATCAC
        TATACTTTCGGAATGAATAAAACCCTTTATAATCTTATTTCTTATTCCTATGTTTAATATTTATTTTATTGTAATATATA
        TAACTAAACTATCTCAAGCCACGCGAAGTTTTGACACCCTTTATCGATCGCAGGCCAAGAAATCATTAGTGTTTTTGTTT
        GCCTAAGTTACACATTTTTGTTTAAATAAATGAACAAGTATAATACTTAACAATGACAAACCAAACAGAGCTGTGCTTAA
        GTTCATCACCGATCGAGGAGCCACTATCAGGGATATAGTTCGCGTTTTATATACTCCCCAGTAAATTGGACTGGAAGCTT
        TGATTACGATTCTCAACAACAGCTTGTGTTTCAAACCAAGCAAAGCGTGTTTTAATTTTTTTGGATACCCTTTATGGAGC
        GCATCAAAATGCAGCCAAAATGCTTTAATTGTTTTTGATCCACGGACGGAGTCCAATCAGGACCCTCTTAAAAATATTTA
        CAAAACAAAATATATATACTTAAAAACTAATATTGCACTTGTCTCGCACCAATATAAGATATTGAACTGTAGAGTGATAA
        CGCTAAACTTTTCCAAGAAAAACAAAATGAACATAACTATTTTATAAAAAGAGAGAACTTAAGAGAGAGCATGTGTGTGC
        GACATTGTCGAAAATTTAACTTCATCTCTAAATTTTAGTGTTACTACAACAAAATATAAATCACAAATTTGCACCAAGTA
        AGTAAGTAGAATGTTAAAATCAAATATTACACAAGGCAAAATGAGTTGTCAACAGCCCTGATAGGAAACGATTTTTGCAA
        ATAATATGAAATGTGGGGATAACACGATTAAAAATGAAATATACAATTTACTATTTAATGC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0075264
        3698
        FBtr0075263
        4384
        FBtr0075267
        3718
        FBtr0075268
        3691
        FBtr0075269
        3742
        FBtr0112860
        4028
        FBtr0333214
        4376
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0075026
        1008
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0075024
        1008
        FBpp0075023
        1008
        FBpp0075027
        1017
        FBpp0075028
        1008
        FBpp0075029
        1017
        FBpp0111773
        1105
        FBpp0305416
        1105
        Comments

        Extended 3' UTR based on RNA-Seq and/or EST data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG11661-RA
        Nc73EF-RA
        Secondary FlyBase IDs
          References (2)