Open Close
General Information
Symbol
Dmel\Nc73EF-RF
Species
D. melanogaster
Annotation Symbol
CG11661-RF
FlyBase ID
FBtr0075267
Feature type
Associated gene
Evidence Rank
Length (nt)
3718
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 107 )
Sequence
TAACAGTCCCACCACTAACGCAAAAGTTTTCGGCTGTAAAAACTTCTATTTTGTAAAGCTACAAAATGCATAGAGCCCAC
ACAGCCTTCAGCCTGGCCTTGTCGCCGATGGCGCACAAGAACTTCGCCACATGGCTGCTCAAGAGCAGCAGCAGTCAGCA
GATGGCCAAGGTAACTGCAGCGGCCGCTGTGCGCACCTACAACTCCGCAGCTGCCGAACCTTTTGCCAACGGCAGCACCG
CCTCCTACGTGGAGGAGATGTACAACGCCTGGCTTCGGGATCCCACTTCCGTGCACACCTCCTGGGACGCGTACTTCCGC
AGCAACAGCTACGTTAGCCCGCCCAACTTGGCGCCCGTGCAGGCCAACACTCTGCCGCTGACCGCCTTCAACTTTGGAGG
AGCCGTCGCCGGCGCTGCGCCCGACTCCAAGACCATTGACGACCATCTGGCCGTCCAGGCCATCATCAGGAGCTACCAGT
CACGAGGTCATTTGGCATCTGATCTGGATCCGCTTGGAATTTTGACTCGCGAAAAAACCGTCTGCAAGGATGGGCTAGCA
CGTCGTGCTAACGAAGATGTGCTCAGGCAGCACTCTGGGTTTTTGTTTGGCGAGCAGGACATGGATCGCCAGTTCAAGCT
GCCCAGCACTACCTTCATCGGAGGCGATGAGGCTTCGTTGCCCCTAAAGGAAATCCTGAACCGCCTGGAGAATGTCTACT
GTAATAAGATTGGCGTGGAGTTCATGTTCATCAACTCTCTGGAGCAATGCAACTGGATCCGCAAGCGTTTTGAGACCCCC
GGCGTCCTTAACTTCTCGCCCGAGGAGAAGCGTCTGATCCTGGCCCGTTTGACCCGTGCCACCGGCTTTGAGGCTTTCCT
GGCCAAGAAGTACTCTTCTGAGAAACGTTTCGGTCTGGAGGGTTGCGAGATCATGATCCCAGCCCTGAAGGAGATCATCG
ACGTATCAACGGAGTTGGGAGTGGAGTCGGTCATCATGGGCATGCCCCATCGTGGACGTCTTAACACCTTGGCCAATGTA
TGCCGCAAGCCCTTGAACCAGATCTTCACCCAGTTCGCTGGACTGGAGGCTGCTGATGATGGCTCTGGTGATGTCAAGTA
CCATCTCGGTACATACATCGAGCGATTGAACCGCGTTACAAACAAGAACATCCGCCTGGCTGTCGTGGCCAACCCGTCCC
ATCTGGAGGCTGTGGATCCCGTGGTGCAGGGCAAGACCCGTGCCGAGCAGTTCTACCGTGGCGACCAGGAGGGCAAGAAG
GTTATGTCCATTTTGATCCACGGTGATGCCGCCTTCTGCGGACAGGGCGTCGTCTATGAAACTATGCATCTTTCGGACCT
GCCCGACTACACCACCCACGGAACTATCCATGTGGTGGCCAACAACCAGATCGGTTTCACCACCGATCCCCGTTTCTCGA
GGTCCTCTCCCTACTGTACGGATGTGGCTCGTGTCGTCAATGCTCCTATTTTCCACGTCAACGCTGACGATCCAGAGGCC
GTGATGCATGTGTGCAAGGTGGCTGCTGAGTGGCGTGCTACTTTCCACAAGGATTGTGTTATTGATTTGGTCGGATACCG
CCGCAATGGACACAACGAGATCGACGAGCCCATGTTCACGCAACCCTTGATGTACCAGAAGATCCGCAAGCACAAGAACT
GTCTCGACCTGTATGCCGACAAACTGATCGCCGAGGGCACTGTCACCGCCGAGGAGGTTAAGTCGGTTGCCGCTAAATAC
GAGAACATTTGCGAGGAGGCATTCGCTCTGGCCAAGACCGAGACCCACGTCAAGTACAAGGACTGGCTCGACTCGCCCTG
GTCCGGCTTTTTCGAGGGCAAAGACCCATTGAAGGTAGCGCCCACTGGAGTGAAGGAGGAGACCCTCATCCACATCGGCA
ACCGCTTCTCGTCGCCACCACCGAACGCTGCTGAATTCGTGATTCACAAGGGTCTATTGCGAGTGTTGGCCGCTCGCAAG
GCAATGGTGGACGAAAAGGTCGCTGATTGGGCTTTGGGAGAGGCCATGGCCTTCGGCTCTCTGCTGAAGGAGGGAATCCA
TGTGCGCCTTTCGGGACAGGATGTCGAGCGTGGTACCTTCTCGCATCGCCACCATGTGCTGCACCACCAGCTGGTCGACA
AGGCCACTTACAACTCGCTGCAGCACATGTACCCAGATCAGGCGCCCTACTCCGTCTCCAACAGCTCGCTGTCGGAGTAC
GCAGTGCTTGGTTTCGAGCACGGTTACTCGATGACCAATCCCAATGCCCTGGTGCTGTGGGAGGCTCAGTTCGGAGACTT
CAGCAACACGGCCCAGTCGATCATCGATCAGTTCATCTCCAGCGGTCAGTCAAAGTGGGTGCGCCAATCGGGTCTGGTAA
TGCTCCTGCCCCACGGCATGGAAGGCATGGGCCCCGAGCACTCCTCGTGCCGCGTGGAGCGCTTCCTGCAAATGAGCAGT
GACGATCCCGACTACTTCCCACCAGAGTCCGATGAGTTCGGAGTGCGACAGCTGCACGACATTAACTGGATCGTGGCAAA
CTGCTCGACGCCCGCCAACTACTACCACATCCTGCGCCGACAGATCGCATTGCCTTTCCGCAAGCCCCTGATTCTGTGCA
CGCCCAAATCGCTGCTGCGTCACCCCGAGGCTAAGAGTCCTTTCAGCGAGATGAGCGAGGGCAGCGAGTTCCAGCGCATC
ATCCCCGACAACGGTCCCGCCGGCCAGAATCCCAGCAATGTGAAGAAGGTCGTCTTCTGCTCGGGCCGCGTCTACTACGA
TTTGACCAAGACACGTAGGGAAAAGCAGCTGGAGGGCGAAATCGCCATTGTGCGCGTGGAGCAGATCTCTCCCTTCCCCT
TCGATCTGGTCAAGGAGCAGGCCAACCTGTACAAGAATGCCGAACTCGTGTGGGCCCAAGAGGAGCACAAGAACCAGGGC
AGCTGGACCTATGTGCAACCTCGTTTCCTCACCGCCTTGAACCACAGCCGCGACGTCAGCTACGTCGGACGCGCCTGCGG
AGCCTCCACCGCCACCGGATCCAAGGCCCAGCACATCCGTGAGCTGAATGCGCTGCTCAACGACGCGATTTCGACCTAAG
GAGATGGGTCTTGATGAAGATGAGATTGGGATGAAGATGGAGATGGAGACGATGAATATTAATTACGATTATATTTTGTA
TTGAAACGTATGCAGACTCTTTGATACGATTTTTTGCTGACGAAATTGTTAAGAGCATTGTGTGAAAGTAATGAAATGTT
AAATATTAGTTTAGTGAAATTACAAGAGCTAACGGCAACCAAGTAACAAATAACACGAAATGTTAAGTGTTTAGTAAAGA
ATCAAACAAAACGAAAAAGAACTACAACCACTCACAGCAAGTCTTTAATACAAACTAAAGAGCCAAGATCTAGTAAATAG
CCAACTAACCTATGCGCATACATTTGAAGTGATGAGAACTCGCATAGGAGGAGGATATCACTATACTTTCGGAATGAATA
AAACCCTTTATAATCTTATTTCTTATTCCTATGTTTAATATTTATTTTATTGTAATATATATAACTAAACTATCTCAAGC
CACGCGAAGTTTTGACACCCTTTATCGATCGCAGGCCAAGAAATCATTAGTGTTTTTGTTTGCCTAAGTTACACATTTTT
GTTTAAATAAATGAACAAGTATAATACTTAACAATGAC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0075266
4381
FBtr0075264
3698
FBtr0075263
4384
FBtr0075268
3691
FBtr0075269
3742
FBtr0112860
4028
FBtr0333214
4376
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0075027
1017
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0075026
1008
FBpp0075024
1008
FBpp0075023
1008
FBpp0075028
1008
FBpp0075029
1017
FBpp0111773
1105
FBpp0305416
1105
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG11661-RF
Nc73EF-RF
Secondary FlyBase IDs
    References (2)