Open Close
General Information
Symbol
Dmel\brm-RC
Species
D. melanogaster
Annotation Symbol
CG5942-RC
FlyBase ID
FBtr0075523
Feature type
Associated gene
Evidence Rank
Length (nt)
5327
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 47 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATTAGAGTTTTGCCGTCGCGTCGCGTTGTGAAAAGAGAAGAAAACCTTCTGAAAACAGTGCTAATAGATTAGGCTGCACC
      AGTTGCTGGATATCGCTATTGGATAAAGTCAAGAAAGGAGCTGCAATATGGCCTCGCCCTCTCCGGCGAACAGTCCCATG
      CCACCGCCACAGGCGCCCAGTCCGATGGCCCCGCCCTCGCAGAGTCCCGCCCCCTCGCCGCACAGCCCGTATCCGCACCA
      GCAGCCGGGTCCACTGCAAGGACCTCCGCCACCCGGACATCCCGGTGCCTACGGACATCCCATGCAGCACGGACCACCCG
      GCCAGGGTCCACCCGGGCATCATATGCCACCGCACCACCAGGGGATGAGTCCGCACATGGGAATGCAGATGCCGCCGACG
      GGACCGAACATGTCCCCCTACCAAACCCACGGAATGCCACCCAATGCACCCACACAACCCTGCATAGTGTCACCTGGTGG
      CCCACCTGGAGGCCCGCCACCTCCGGAGCGCTCGAGCCAGGAGAACCTGCACGCGCTTCAACGCGCCATTGATTCAATGG
      AGGAAAAGGGCTTGCAAGAGGATCCTCGCTACTCGCAGCTGCTGGCAATGCGAGCAACCTCGAAGCATCAGCACCTTAAT
      GGCAATCAGGTTAACTTGTTGCGCACACAGATCACCGCCTATCGGTTGCTGGCGCGGAACAAGCCCATATCCATGCAGAT
      GCAGCAGGCGTTGCAGGCCGCACAGCAACAGCCACCGCCAGGACCTCCAATTGGGCCACCTGGAGCACCAGGCGGACCGC
      CACCAGGGAGCCAGCATGCAGGACAACCGCCCGTGCCGCCGCAACAACAGCAACAACCGCCACCTTCAGCAGGAACTCCA
      CCCCAGTGCTCCACGCCGCCCGCAAGCAATCCTTATGGACCGCCAGTTCCTGGCCAGAAAATGCAGGTAGCGCCACCACC
      GCCACACATGCAACAGGGACAGCCATTGCCACCACAACCGCCACAAGTGGGTGGACCCCCGCCTATACAACAGCAGCAAC
      CACCTCAGCAGCAGCAACAACAGTCGCAGCCCCCGCCACCGGAGCCACATCAGCACCAGTTGCCAAACGGAGGCAAACCC
      CTGAGTATGGGGCCATCTGGCGGGCAACCACTAATACCTTCATCACCCATGCAGCCACAAGTGAGAGGGACACTGCCAGG
      AATGCCGCCAGGTAGTCAGGTTCCGCAACCAGGAGGAGGTCCTCAGCGACAGGTACCACCTGCGGGCATGCCGATGCCCA
      AGCCCAATCGCATTACAACGGTGGCCAAACCCGTCGGTCTGGATCCCATAACATTGCTGCAGGAAAGGGAGAATAGGATA
      GCAGCCAGGATATCATTGCGCATGCAGGAGTTGCAGCGACTGCCGGCCACGATGTCCGAGGATCTGCGTCTGCAAGCGGC
      TATCGAGTTGAGGGCCCTAAGGGTCTTGAACTTCCAGCGACAGCTGCGTATGGAGTTTGTTCAGTGCACGAGACGAGATA
      CCACTTTGGAAACAGCGTTAAACATTAAGCTCTACAAGAGGACCAAGAGGCAGGGCCTGCGGGAGGCACGTGCCACCGAG
      AAGCTAGAGAAGCAACAGAAGCTAGAGGCTGAACGAAAGCGTCGCCAAAAGCATCTGGAGTTCTTGGCTGCTGTGCTTCA
      GCACGGCAAGGATCTAAGGGAGTTCCACAGAAATAATAAGGCCCAGCTTGCAAGGATGAACAAGGCCGTGATGAATCACC
      ACGCCAATGCCGAGCGTGAACAGAAGAAGGAACAAGAGCGCATCGAAAAGGAACGTATGCGACGTCTGATGGCCGAGGAT
      GAGGAGGGTTACCGCAAGCTGATTGATCAAAAGAAGGACAAGAGATTGGCTTTCCTACTGTCGCAGACAGATGAGTATAT
      TAGCAACCTAACTCAGATGGTGAAACAGCACAAGGACGACCAGATGAAGAAAAAGGAGGAGGAGGGCAAGCGGCTGATAC
      AGTTCAAAAAGGAGCTGCTGATGAGCGGAGAGTACATTGGCATTGATGAGGGCAGCATTGTTGCCGATATGCGGGTACAT
      GTGGTGGAACAGTGCACGGGTAAGAAACTCACCGGCGATGATGCACCCATGCTGAAGCACTTGCACCGCTGGCTGAATAT
      GCATCCTGGCTGGGATTGGATCGACGACGAGGAGGACAGCTGTGGGAGCAACGACGATCATAAACCCAAGGTGGAGGAGC
      AACCAACGGCAACAGAAGATGCCACCGACAAAGCGCAGGCGACGGGCAACGATGAGGATGCCAAGGATCTAATTACCAAG
      GCCAAGGTGGAGGACGATGAGTACAGGACGGAGGAACAGACGTACTACAGCATCGCTCATACCATTCATGAAAAGGTTGT
      GGAGCAGGCCAGCATCATGGTTAATGGTACGCTCAAGGAATACCAGATCAAAGGCTTGGAGTGGTTGGTTTCGCTGTACA
      ATAACAATCTAAATGGTATTTTGGCCGATGAAATGGGTTTGGGTAAAACCATTCAAACCATTTCGCTGGTAACCTACCTT
      ATGGATCGAAAGAAGGTTATGGGTCCTTACTTGATTATTGTACCACTCTCCACCCTGCCCAATTGGGTGCTGGAATTCGA
      GAAGTGGGCGCCAGCCGTGGGTGTAGTCAGCTACAAGGGCAGTCCGCAGGGAAGGCGATTGCTGCAAAATCAAATGAGAG
      CAACCAAGTTCAATGTGCTGTTAACCACATATGAGTACGTGATTAAGGACAAGGCGGTGCTGGCCAAGATCCAGTGGAAA
      TACATGATTATCGACGAGGGTCACCGCATGAAGAACCATCACTGCAAACTCACCCAGGTGCTGAACACCCACTACATTGC
      CCCCTATCGGTTACTTCTCACGGGTACACCTCTGCAAAACAAGCTTCCCGAGTTGTGGGCGCTACTTAATTTCCTGCTGC
      CCTCGATCTTTAAGTCCTGCTCCACATTTGAACAGTGGTTCAATGCGCCATTTGCCACCACTGGCGAGAAGGTCGAGCTA
      AACGAGGAGGAGACCATCCTTATCATTCGTCGTCTGCACAAGGTTCTTCGTCCTTTCCTGTTGCGTCGCCTCAAAAAGGA
      GGTAGAGCACCAGCTGCCCGACAAGGTCGAGTACATCATCAAGTGCGACATGTCCGCGCTGCAACGCGTTCTCTACAAGC
      ACATGCAGAGCAAGGGTGTCCTGCTCACCGATGGTTCCGAGAAGGGCAAGCACGGCAAGGGAGGCGCTAAGGCGCTGATG
      AACACGATCGTACAGCTGCGCAAGCTGTGCAACCATCCGTTTATGTTCCAGCACATAGAAGAGAAGTACTGCGATCACAC
      TGGCGGCCACGGAGTTGTATCCGGACCGGATCTGTATCGTGTCTCTGGCAAATTCGAGCTGCTTGATCGCATCCTGCCCA
      AGCTGAAGGCGACCAATCATCGCGTGCTGCTCTTCTGTCAGATGACCCAATGCATGACCATCATCGAAGACTACCTGGGA
      TGGCGCCAATTCGGCTACCTTCGACTCGACGGTACCACGAAGGCCGAGGATCGTGGCGAACTACTGCGAAAATTCAACGC
      CAAAGGCTCGGATGTATTTGTCTTTTTGCTATCTACCCGAGCTGGTGGTTTGGGTCTTAATCTGCAGACCGCCGATACTG
      TAGTAATCTTCGACTCCGATTGGAATCCCCATCAGGATCTGCAAGCCCAGGATCGTGCCCATCGTATTGGTCAACGTAAC
      GAGGTGCGCGTCCTGCGACTAATGACAGTCAACTCGGTGGAAGAGCGCATCTTGGCAGCAGCCAGGTACAAGCTGAACAT
      GGACGAGAAGGTCATCCAGGCTGGTATGTTCGATCAGAAGTCAACGGGTAGCGAGCGACAGCAGTTCCTACAAACGATTC
      TGCACCAGGATGACAACGAAGAGGAGGAGGAAAATGAGGTGCCCGATGACGAAATGATCAACATGATGATCGCCCGCAGC
      GAGGAGGAGATTGAAATATTTAAGCGCATGGATGCTGAGCGCAAGAAGGAGGATGAGGAGATCCATCCGGGTAGGGAACG
      TCTGATCGATGAGTCCGAGCTACCCGACTGGTTGACAAAGGATGATGACGAAGTAGAGCGTTTCCACTATCAGTACGACG
      AGGATACCATTCTAGGTCGAGGCTCCCGGCAGCGAAAGGAAGTAGACTACACCGATAGTTTGACTGAAAAGGAGTGGCTG
      AAAGCCATCGACGATGGCGCTGAGTTCGACGAGGAAGAGGAGGAAGACGATTCGAAGCGCAAGCGACGAAAGCGTAAGAA
      TCGGAAGGAAGAGTCCGACGATGATTCGTTGATCCTAAAACGGCGACGACGCCAAAATCTGGACAAGCGGTCCAAGAAGC
      AGATGCACAAGATTATGAGTGCGGTTATCAAGCACAACCAAGATGGACGAACCCTGTCCGAACCGTTCATGAAGTTGCCT
      TCGCGGCAGAGGTTGCCCGACTACTACGAGATCATTAAGCGGCCAGTTGATATTAAGAAAATCCTGCAGCGCATTGAGGA
      CTGCAAGTATGCCGATCTCAACGAGCTGGAGAAGGACTTTATGCAGCTATGCCAGAATGCACAGATCTACAACGAAGAGG
      CGTCTCTGATTTACCTGGACTCGATTGCCCTGCAAAAGGTATTCGTTGGGGCCAGGCAGAGGATAACAGCTGCAGCGGAT
      GCAGCCGCAGTGGCAGCCGGAGATAACACGGGTGAAGCGCACGGCAATGGAGGTTCGGATAATTCGGACAACGACGACGA
      CGATGGTGGCGATGACGGCTCCGACGACGAGGAGATTGCAACCACTTCAGCGGCGGCTGTCAAAATGAAGCTGAAACTGA
      ACAAATCTCTGGCTAGTGCGCCCGCTACGCCCACGCAATCATCGTCGAATGTGAGCAGCGGAGCGGCTACCACATCCAAG
      AAGCAGACGCGTCGCAAGCGCTCCCAAAAGAAGTACACTATTTCAGACGATGACGACGATGACATGGACTAGCTACCGTT
      GGGAGTGATCTTCAAGCGCGGATCGTCGGATGTCGAAGGCATGGGCAATTGATTATTAATTAGTTTAAGTTTTACTTTCA
      AGGACGATGCTTACCAAAACCCTAGCCTACGGGTTTTTTTAACCATCTAACCTATCATGCTATCACTTTTATCTATACTA
      ATTTTCTAGTTGTAGGTTCTCGATTAAGTTTCCTATTCAATTATTTTCGCACACACCATTTATTTCTCCCAATTCTATTG
      ATTGTATAATTATGTGCTTTAAAATAAATGCATACCTAACATAAAGT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0075525
      5339
      FBtr0075526
      5553
      FBtr0075524
      5322
      FBtr0330160
      5339
      FBtr0333580
      5351
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0075278
      1634
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0075280
      1638
      FBpp0075281
      1638
      FBpp0075279
      1634
      FBpp0303193
      1658
      FBpp0305757
      1642
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG5942-RC
      Secondary FlyBase IDs
        References (2)