Open Close
General Information
Symbol
Dmel\brm-RB
Species
D. melanogaster
Annotation Symbol
CG5942-RB
FlyBase ID
FBtr0075526
Feature type
Associated gene
Evidence Rank
Length (nt)
5553
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 48 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TCGCGTTGTGAAAAGAGAAGAAAACCTTCTGAAAACAGTGCTAATAGGTAATACTTTCGGTGCCAAATGGAGCAATCCGA
        TTGCGTTCTTCGCGTGCGATTAGCGTGCAGTTGATTTCGGCCGATTTGGCGTATCTTTAGCCGTTATTTTGGGTTTGCAC
        CGGGCTGCGCGAAAAAGTGTGCCAAAAGAGGCACACAAAACGGTAGCTACGATTACATATCGTGGCTATAGCTTCTTTAA
        TGTTGGTAAATACAGTGCATTGACGTGTGTTCCATCTGCAGATTAGGCTGCACCAGTTGCTGGATATCGCTATTGGATAA
        AGTCAAGAAAGGAGCTGCAATATGGCCTCGCCCTCTCCGGCGAACAGTCCCATGCCACCGCCACAGGCGCCCAGTCCGAT
        GGCCCCGCCCTCGCAGAGTCCCGCCCCCTCGCCGCACAGCCCGTATCCGCACCAGCAGCCGGGTCCACTGCAAGGACCTC
        CGCCACCCGGACATCCCGGTGCCTACGGACATCCCATGCAGCACGGACCACCCGGCCAGGGTCCACCCGGGCATCATATG
        CCACCGCACCACCAGGGGATGATTTTCTCAAAAGGTCCGCACATGGGAATGCAGATGCCGCCGACGGGACCGAACATGTC
        CCCCTACCAAACCCACGGAATGCCACCCAATGCACCCACACAACCCTGCATAGTGTCACCTGGTGGCCCACCTGGAGGCC
        CGCCACCTCCGGAGCGCTCGAGCCAGGAGAACCTGCACGCGCTTCAACGCGCCATTGATTCAATGGAGGAAAAGGGCTTG
        CAAGAGGATCCTCGCTACTCGCAGCTGCTGGCAATGCGAGCAACCTCGAAGCATCAGCACCTTAATGGCAATCAGGTTAA
        CTTGTTGCGCACACAGATCACCGCCTATCGGTTGCTGGCGCGGAACAAGCCCATATCCATGCAGATGCAGCAGGCGTTGC
        AGGCCGCACAGCAACAGCCACCGCCAGGACCTCCAATTGGGCCACCTGGAGCACCAGGCGGACCGCCACCAGGGAGCCAG
        CATGCAGGACAACCGCCCGTGCCGCCGCAACAACAGCAACAACCGCCACCTTCAGCAGGAACTCCACCCCAGTGCTCCAC
        GCCGCCCGCAAGCAATCCTTATGGACCGCCAGTTCCTGGCCAGAAAATGCAGGTAGCGCCACCACCGCCACACATGCAAC
        AGGGACAGCCATTGCCACCACAACCGCCACAAGTGGGTGGACCCCCGCCTATACAACAGCAGCAACCACCTCAGCAGCAG
        CAACAACAGTCGCAGCCCCCGCCACCGGAGCCACATCAGCACCAGTTGCCAAACGGAGGCAAACCCCTGAGTATGGGGCC
        ATCTGGCGGGCAACCACTAATACCTTCATCACCCATGCAGCCACAAGTGAGAGGGACACTGCCAGGAATGCCGCCAGGTA
        GTCAGGTTCCGCAACCAGGAGGAGGTCCTCAGCGACAGGTACCACCTGCGGGCATGCCGATGCCCAAGCCCAATCGCATT
        ACAACGGTGGCCAAACCCGTCGGTCTGGATCCCATAACATTGCTGCAGGAAAGGGAGAATAGGATAGCAGCCAGGATATC
        ATTGCGCATGCAGGAGTTGCAGCGACTGCCGGCCACGATGTCCGAGGATCTGCGTCTGCAAGCGGCTATCGAGTTGAGGG
        CCCTAAGGGTCTTGAACTTCCAGCGACAGCTGCGTATGGAGTTTGTTCAGTGCACGAGACGAGATACCACTTTGGAAACA
        GCGTTAAACATTAAGCTCTACAAGAGGACCAAGAGGCAGGGCCTGCGGGAGGCACGTGCCACCGAGAAGCTAGAGAAGCA
        ACAGAAGCTAGAGGCTGAACGAAAGCGTCGCCAAAAGCATCTGGAGTTCTTGGCTGCTGTGCTTCAGCACGGCAAGGATC
        TAAGGGAGTTCCACAGAAATAATAAGGCCCAGCTTGCAAGGATGAACAAGGCCGTGATGAATCACCACGCCAATGCCGAG
        CGTGAACAGAAGAAGGAACAAGAGCGCATCGAAAAGGAACGTATGCGACGTCTGATGGCCGAGGATGAGGAGGGTTACCG
        CAAGCTGATTGATCAAAAGAAGGACAAGAGATTGGCTTTCCTACTGTCGCAGACAGATGAGTATATTAGCAACCTAACTC
        AGATGGTGAAACAGCACAAGGACGACCAGATGAAGAAAAAGGAGGAGGAGGGCAAGCGGCTGATACAGTTCAAAAAGGAG
        CTGCTGATGAGCGGAGAGTACATTGGCATTGATGAGGGCAGCATTGTTGCCGATATGCGGGTACATGTGGTGGAACAGTG
        CACGGGTAAGAAACTCACCGGCGATGATGCACCCATGCTGAAGCACTTGCACCGCTGGCTGAATATGCATCCTGGCTGGG
        ATTGGATCGACGACGAGGAGGACAGCTGTGGGAGCAACGACGATCATAAACCCAAGGTGGAGGAGCAACCAACGGCAACA
        GAAGATGCCACCGACAAAGCGCAGGCGACGGGCAACGATGAGGATGCCAAGGATCTAATTACCAAGGCCAAGGTGGAGGA
        CGATGAGTACAGGACGGAGGAACAGACGTACTACAGCATCGCTCATACCATTCATGAAAAGGTTGTGGAGCAGGCCAGCA
        TCATGGTTAATGGTACGCTCAAGGAATACCAGATCAAAGGCTTGGAGTGGTTGGTTTCGCTGTACAATAACAATCTAAAT
        GGTATTTTGGCCGATGAAATGGGTTTGGGTAAAACCATTCAAACCATTTCGCTGGTAACCTACCTTATGGATCGAAAGAA
        GGTTATGGGTCCTTACTTGATTATTGTACCACTCTCCACCCTGCCCAATTGGGTGCTGGAATTCGAGAAGTGGGCGCCAG
        CCGTGGGTGTAGTCAGCTACAAGGGCAGTCCGCAGGGAAGGCGATTGCTGCAAAATCAAATGAGAGCAACCAAGTTCAAT
        GTGCTGTTAACCACATATGAGTACGTGATTAAGGACAAGGCGGTGCTGGCCAAGATCCAGTGGAAATACATGATTATCGA
        CGAGGGTCACCGCATGAAGAACCATCACTGCAAACTCACCCAGGTGCTGAACACCCACTACATTGCCCCCTATCGGTTAC
        TTCTCACGGGTACACCTCTGCAAAACAAGCTTCCCGAGTTGTGGGCGCTACTTAATTTCCTGCTGCCCTCGATCTTTAAG
        TCCTGCTCCACATTTGAACAGTGGTTCAATGCGCCATTTGCCACCACTGGCGAGAAGGTCGAGCTAAACGAGGAGGAGAC
        CATCCTTATCATTCGTCGTCTGCACAAGGTTCTTCGTCCTTTCCTGTTGCGTCGCCTCAAAAAGGAGGTAGAGCACCAGC
        TGCCCGACAAGGTCGAGTACATCATCAAGTGCGACATGTCCGCGCTGCAACGCGTTCTCTACAAGCACATGCAGAGCAAG
        GGTGTCCTGCTCACCGATGGTTCCGAGAAGGGCAAGCACGGCAAGGGAGGCGCTAAGGCGCTGATGAACACGATCGTACA
        GCTGCGCAAGCTGTGCAACCATCCGTTTATGTTCCAGCACATAGAAGAGAAGTACTGCGATCACACTGGCGGCCACGGAG
        TTGTATCCGGACCGGATCTGTATCGTGTCTCTGGCAAATTCGAGCTGCTTGATCGCATCCTGCCCAAGCTGAAGGCGACC
        AATCATCGCGTGCTGCTCTTCTGTCAGATGACCCAATGCATGACCATCATCGAAGACTACCTGGGATGGCGCCAATTCGG
        CTACCTTCGACTCGACGGTACCACGAAGGCCGAGGATCGTGGCGAACTACTGCGAAAATTCAACGCCAAAGGCTCGGATG
        TATTTGTCTTTTTGCTATCTACCCGAGCTGGTGGTTTGGGTCTTAATCTGCAGACCGCCGATACTGTAGTAATCTTCGAC
        TCCGATTGGAATCCCCATCAGGATCTGCAAGCCCAGGATCGTGCCCATCGTATTGGTCAACGTAACGAGGTGCGCGTCCT
        GCGACTAATGACAGTCAACTCGGTGGAAGAGCGCATCTTGGCAGCAGCCAGGTACAAGCTGAACATGGACGAGAAGGTCA
        TCCAGGCTGGTATGTTCGATCAGAAGTCAACGGGTAGCGAGCGACAGCAGTTCCTACAAACGATTCTGCACCAGGATGAC
        AACGAAGAGGAGGAGGAAAATGAGGTGCCCGATGACGAAATGATCAACATGATGATCGCCCGCAGCGAGGAGGAGATTGA
        AATATTTAAGCGCATGGATGCTGAGCGCAAGAAGGAGGATGAGGAGATCCATCCGGGTAGGGAACGTCTGATCGATGAGT
        CCGAGCTACCCGACTGGTTGACAAAGGATGATGACGAAGTAGAGCGTTTCCACTATCAGTACGACGAGGATACCATTCTA
        GGTCGAGGCTCCCGGCAGCGAAAGGAAGTAGACTACACCGATAGTTTGACTGAAAAGGAGTGGCTGAAAGCCATCGACGA
        TGGCGCTGAGTTCGACGAGGAAGAGGAGGAAGACGATTCGAAGCGCAAGCGACGAAAGCGTAAGAATCGGAAGGAAGAGT
        CCGACGATGATTCGTTGATCCTAAAACGGCGACGACGCCAAAATCTGGACAAGCGGTCCAAGAAGCAGATGCACAAGATT
        ATGAGTGCGGTTATCAAGCACAACCAAGATGGACGAACCCTGTCCGAACCGTTCATGAAGTTGCCTTCGCGGCAGAGGTT
        GCCCGACTACTACGAGATCATTAAGCGGCCAGTTGATATTAAGAAAATCCTGCAGCGCATTGAGGACTGCAAGTATGCCG
        ATCTCAACGAGCTGGAGAAGGACTTTATGCAGCTATGCCAGAATGCACAGATCTACAACGAAGAGGCGTCTCTGATTTAC
        CTGGACTCGATTGCCCTGCAAAAGGTATTCGTTGGGGCCAGGCAGAGGATAACAGCTGCAGCGGATGCAGCCGCAGTGGC
        AGCCGGAGATAACACGGGTGAAGCGCACGGCAATGGAGGTTCGGATAATTCGGACAACGACGACGACGATGGTGGCGATG
        ACGGCTCCGACGACGAGGAGATTGCAACCACTTCAGCGGCGGCTGTCAAAATGAAGCTGAAACTGAACAAATCTCTGGCT
        AGTGCGCCCGCTACGCCCACGCAATCATCGTCGAATGTGAGCAGCGGAGCGGCTACCACATCCAAGAAGCAGACGCGTCG
        CAAGCGCTCCCAAAAGAAGTACACTATTTCAGACGATGACGACGATGACATGGACTAGCTACCGTTGGGAGTGATCTTCA
        AGCGCGGATCGTCGGATGTCGAAGGCATGGGCAATTGATTATTAATTAGTTTAAGTTTTACTTTCAAGGACGATGCTTAC
        CAAAACCCTAGCCTACGGGTTTTTTTAACCATCTAACCTATCATGCTATCACTTTTATCTATACTAATTTTCTAGTTGTA
        GGTTCTCGATTAAGTTTCCTATTCAATTATTTTCGCACACACCATTTATTTCTCCCAATTCTATTGATTGTATAATTATG
        TGCTTTAAAATAAATGCATACCTAACATAAAGT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0075525
        5339
        FBtr0075523
        5327
        FBtr0075524
        5322
        FBtr0330160
        5339
        FBtr0333580
        5351
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0075281
        1638
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0075280
        1638
        FBpp0075278
        1634
        FBpp0075279
        1634
        FBpp0303193
        1658
        FBpp0305757
        1642
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG5942-RB
        Secondary FlyBase IDs
          References (2)