Open Close
General Information
Symbol
Dmel\mex1-RA
Species
D. melanogaster
Annotation Symbol
CG7936-RA
FlyBase ID
FBtr0075602
Feature type
Associated gene
Evidence Rank
Length (nt)
710
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 6 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CTTCAGTTAATATTTTGTGTTGGTCAACCACGCATCGGGAATCGGAAATATACTGTACAGTATATCTATCTATAATAGAA
      TAACCCAAAAAAGTCATCACCATGTGCAACGCTCTCTGTGAATGCCTCAAATGTCCCGGCAAAGTGGTTTGCTGCTGCTG
      TTCCTGCGCCTGCAAGATGCTCCTGAGCATCGTGTTTTCTGCGCTCCTGATGGTCGTGGTGATCGGCTTGATTGTCTACT
      TCACGGTCTTCTATCACAAGGATAAGAACACGGATGAGGTGCAGAAGCAGGTCGCCCAACTGACGCCCATTGTGAAGCGC
      AGCATACGCGACTACTTCAACAAGGAGTACTGATCTGAGGACATGAATTTATACTATAGGCCATATTAATAATAACTCCG
      TCGAAATCGAAATTGAAACGAACTAAGAACCAAAGCCGTTCAGTGCATGACTTAATCTAATCGCGTCGGATGCTCGTTAT
      GGGATTTTTTCTTATCTATAGATAGTTTGGGACTCAATTGAATGGGCAATTTGTGCGTTCTTTAGAAAGGTAGATAATGT
      TGGAGCGGCAAAAAATGTGACTCACTGTATACCTTACAATACATTTTGAACTCGAAACCCAGTAAAGCATTCACAATATA
      TATTTAATGTATAATATGTATGAATGTAAGGCAGATTAAAAAAGTTATATTGTACTGGATGACACACTAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0303786
      741
      FBtr0334084
      1034
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0075355
      83
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0292798
      83
      FBpp0306209
      83
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG7936-RA
      Secondary FlyBase IDs
        References (2)