Open Close
General Information
Symbol
Dmel\Nprl3-RB
Species
D. melanogaster
Annotation Symbol
CG8783-RB
FlyBase ID
FBtr0075785
Feature type
Associated gene
Evidence Rank
Length (nt)
2297
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 33 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GCAAACTAAAAGAGAGCCACACTGCTGTAAATATATTTTATATTTTACATTTATTTACTTTGCTTCCATTTCTCAATGAA
        GTCAAATTGAGGGGAAGTGTCTGTGTGCCATGGAAACTAATGTGAATCCCCTGGCCGTAATCCTGGTTTACTTCGATAGC
        AAGGGGGATCGGTTACTGTACAGGTATCCGTACCAGACTCTCGGCCAAACGGAGGTGGCCAACGACGAGCAGCGGAAGTC
        CAGAAAGCGCAATCCCTATGCCGTGGCCAATACGGACGATCTGCTGCAGACACCCACCCACTTGGGTGCTGCCAAGAGCC
        AAGGACAACTGCAGGGATTCGCAGATGAGGTCCTGTCCGCTCTGTTTGCTGTTAAACCACAGCTATGCAACCAAAAGTTT
        GAACTCAAACTGAACGACGTACGCTTTGTCAGTCATCCCACTCTGATACCGCAAAAGGAGCAGAGAAGTGGTCCAATGGC
        CAAGCAACAGATGCTCATCAACATTGTTTTTGCGCTGCATGCACAGGCCAGCTACTCGATTGTTAAGTGCTACCACGAAC
        TGAGCAAGCGCCTTGGACTGGCGCTGAAGTTCGAGGAGCAGCGCAGTGGCTATCTCACCGAGCAGACGGCTCAAATGGCT
        CGCACACACGACGAGCAGCAGCAACAGCCGCTGGAACGCACACTGGAGCTGATTGCAGAGCGCTGCAGCTTGGCACAGGC
        CTTGCGCTCCATCTTCCATGATCTATGCACCACTGGACTGCTGAGTACCTCGCTGAATCACAACCTAACGTTGTGCTTCT
        GTCTGCCCGCTAAGGCACACCAGCTCCATAAGAAGGGCAGCATGGTGGATCCAGAGACCATAGATCGGTGCCTTCGTGCA
        CTGAAGCCCTATCATGGCATGTTGCTGCTGGTCGACTTTGCCGAATTGTTGGACTGCGTTCCACCGACTGGGGCACGCAT
        GCTATGGCAGCTAGTCGACGTCTACGACCCACTGATCAGTCTGCAGAGCATGTCCTCCAATGCAGACTTGAGTATCGAGC
        ATGTTTATAAGCTCGTCTCGCATTTGGTCTACTGGGCTAAGGCAACTATTATTTATCCACTCTGCGAGACAAATGTCTAT
        GTGATCGCGCCGGATGCACCATTGCACACCAAGTCCCACCTGGTGGAGAAGTTCTCGGCCCGTTTTGCCGGTATGTCGCT
        GTTCGAGGTGATCTCCGATTTTTCATTGCCCACTTCAATTGGACACTTAACCACGCCACTGCAGCAGCCAGCGCGACAGG
        GTATCCTCGCACAAATGGTGATTTGGATGCTGCAGCACCATTTGCTCATGCAGTTGCACACGTACGTTCAGTTTATGCCC
        AGCGAGGATGAATTCGGAGATTCGGCCTCCTGCAGCAACCATCTAAGGGATGCCATTAGCGATGAAGAAGGAGACCAAGA
        ACCAGATGCGGACGAGTTGCATGGCTCCATGCTTAGCATGTCCAGTCATCCGTTGCCAGTGCCAGCGGTATTGGTGGGCG
        GACATCGTCGTGAGGCGTCCGAGGACCATTCATCACTGGCCTCGGACAACATCGCCGTGCAGCCATCATCCAGCCACAAG
        TCCAATTTCAGCATCACCGCCTCGATGAGCACGGACAATTGCGACAGCCTCGATTCCATGGAGGATGAGCAGAAGCTGAA
        GGAGCTGCTACAGGTTTTCAGCGATGCGGATCGAGCCGCCATCCGTCGAATTCCCGCCTCTGCCAACGTGGATGATCTAT
        CTCTGCTTGTGAAGCTGTATCAGATGGGTTACTTTAAGAGCGAGCATCATCTGGAGGAGATCATGTACTTCGAGAACCTG
        CGACGTTCGCAACTGCTGCAATTGCTTGATAAATTCAGGGATGTGCTTATCATTTACGAAACCGAAGATCCTGCAATTGC
        ATCCATGTACAATACCAAGTAGAGTTTGGGACGAATTTGCATTCCTAGATTTTAATGTTGAATGTTTTTGTTTAGTTTTT
        GAATATAATCTATAAAATAGGTATGCATCTAATTTTGTAAAGTTTGCGAAGCAAATCAATTTACGCTTGTAGACTACATA
        TTTTGTTATTTATTTGTACAAGCAAGTTCTTAAGTTCAATTCAATTATTGTCAAACTATGTTTTTCCGTGATTTCATACA
        AATTCAAAAAATTACTCATATTCAAAACAGCGTTACATTTTAAGCTTCGCGCCCATTGTACAGCTTTAAGGTATATCGAT
        AAGTGGGGAATATTCTGATGCTCTAAGAGCCAGATTAAAATAAAATATTTAAAAAAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0075786
        2380
        FBtr0333025
        2226
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0075527
        610
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0075528
        610
        FBpp0305239
        610
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG8783-RB
        Nprl3-RB
        Secondary FlyBase IDs
          References (2)