Open Close
General Information
Symbol
Dmel\CG14115-RA
Species
D. melanogaster
Annotation Symbol
CG14115-RA
FlyBase ID
FBtr0075893
Feature type
Associated gene
Evidence Rank
Length (nt)
810
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 2 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACTTAGTTTGTCTGGAGCTCGGGTTAAGATGGGTGCCTTTCGCTGGCAGTTTTACTTGGGTGGAGTTTTCGTTCTTGGCT
        TGAGCTTAGCACATTGTTTTCTGGTGTTTCCTCGTCAGGGATCCTTTGGTCTACTGGCTGCTGTAGCCATTCCACTGGAA
        CTGGGTCCCAAAAATGTGTACATGGCCTTCAACTTTGAGTCCAACTATGCACTGCCCTCCAACGATTCCTACAATCAGTG
        GATTGACAGGTGGGATTTGGATGATCACTATCTGGGCGTCGGAGGCAATGTGACTCCCATAAATGCCCGCCAGGATGGAG
        GTGATTTTTCACAGGACGAGGACAACGAGGTGAGGCGTCGCTCGGTGGGATCTCCGCCTCCCTTCAGGCGCCACGACTTC
        TACCGCAGCATTATAAACTTCCTGACCCACTACGGATTCAATGGCTCCGCCTGCCTGCTGCGAACAATCTGCGAGGTCAG
        CGAATCGCCCCTGGATGATCAAAACGGGCTGCTGGGCAGCCTGTTTCAGATTCTATTCATGCCAACGACAAGTGCCGCGG
        AGCAGGAACTGCAGCACGTGGACGAGCTCTACAAGGCCTCCGATGCGGGCACGCATGGCCCGGGATGCTCCGAGTACGTG
        GCCCACTGCGGACATAGTGCTCTGGACCTGATAAGCATTGTGCTCTGAATAGCCATGTTGGCGACTAGATTTAAATTTAA
        ATTTTAACTTAACTAAAACGCAGCTTCAGACTGGAAGAATTAAGTAAAACTACTTAATTTTCATCAGTATCTGCGATACA
        ACAAGAAAAC
        
        Other Products of this Gene
        Other Transcripts
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0075627
        219
        Derived from OTHER transcripts
        Comments

        3' UTR based on RNA-Seq data.

        Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG14115-RA
        Secondary FlyBase IDs
          References (2)