Open Close
General Information
Symbol
Dmel\Sap130-RC
Species
D. melanogaster
Annotation Symbol
CG11006-RC
FlyBase ID
FBtr0075929
Feature type
Associated gene
Evidence Rank
Length (nt)
4270
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 31 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTATTGTTTTCAATCTGGTAACACTACTTAATTGAGCCTTGTGAAAAGAAGAGCGGAAAACAAGAAAAACTTCTCGTATT
        AATAGGTGGCGCGGTAAAAATCATCAAGTCTAATTTGCTGCGCTTAATGTGTGCGACCAATTAGCATAAAAAGATATCGC
        AAAATCAAAGCTGGAATAATGAGTGCGCCTAGTGAGGGTGGCGCGGGAGGAGGGCCGGTGGGCGGTGGAAGTACAGCTAC
        AGCGCCATCAGCCCCCCTGAAAACCATTAAGATACGCACCCAACAACTGCACACCCATGCAGTGCCATCGTTGTCATTGC
        TGCCATCTATATATCCATCATCATCATCATCATCTCTGGCAGCCACTGGATCTTTATCCGCATCCGCATCCTTGGTATCG
        CACTCACATCCGCCCCTGCAGCTGCGCGGCGTCATAAACAAATACTCATTGCCATCCCATTTGCCATCCTCTGCAGCGCA
        CCCGGCGGTGGCCGCCAAGATCACCCACGTGAAATCCGACGGCGGCGGTGGGATATCCATTGCGGGCACACCGATCCTCA
        GCGGAGGCACAATTAAGGTGGCGTCAGCCAATCAAGTTCAACAAACTTCCCTAGGTGGCACTCCAATTGCTCTGAATGCA
        GGACAAGCGACTACGGCAGCTTCGATCCGTGCTATTGGCGCTGGTGGTCAGTCCACACAGGTGCGGGTGGTGATGCCAAT
        GATCAAGCAGCTAGAGAATGTTACGGCCACCGGAAGGACTCAGATAACAGCCATACCAGCTGCACCGGCGAGGAGTGGGG
        CGAATGCATCGATCACGGTTACCAGGCCCGTAACCCAGGCCACATACTTGCCGCGAGCCAGTGTGACGGCCACCCAAATG
        GGAGGCGTTGGCGTTGGAGTTGGCCAGCGGCTCGTCACGCCATTGAGAGCCACATCATCGGCCACGGTTACGCCCACAGC
        GCCAACAGTGCTGAGCTCAACCGGAGGATTCGTACGCGGAGCAACAGCATCGGTGAGCAGAAGTGGAGTGGCGCTCACAT
        CGCAACCATCGTCGGCTGTCATCTCGTCCAGCAACAGTGGTGCTTGGATGCAGAGTCAGGGACAGGTGCAACTGATCCGA
        ACCATTCATCAGCCGCGCCAGCGAATTATAACGACATCCGCGGGGGTTTCGAATGCCAGTGTAGTGACCACTACTCCAGT
        GCAGGCGCCAACAGCTCTTTCCGTTTCCGCTGGCCAGCCCTTGGCGACACAACAGGCGACGGGACCGGGAGGAGGTCCTC
        AGGCCTATGTGGCTACTGTATTGCCACAGAGGCAGCATCAGGCTACACTAGTTTACTCCTCCAATGTGTCTGCACCGAAT
        GCAAGTCAGAATCCGGGTCAGCAATTTAATCCACGCTTTGCTGTGGCCACGCCCACAGGCGGAGTAACAACAACGACGCC
        CGGTGGAACGACAGTAACACCTCGACAGGTGCGACCAATTCCGCTGGGCAAGAGTTTTCCAACCGCTAAGCTGAACACAA
        CCAGCATAAGTATCAGGGCACCAAGCATACCGCAGCTGAATACCAGCGTTACGGCATCTCCAACGGCCGTTAGTGTTTCC
        GGTGGAGCAACAGTGGCACCCGGGCGGGGTCCCGGAGCCGGAGGAACTGCTCTGACGGCCACTAATTTGCCCACCACACG
        GATCATTCAGCTGCAGCAGCCAGCGACGGGAACCACTCAACAGATCATCGGATCCGGAGCTCGTCTGGCCGGGAACGTGA
        TGCTGCAGCCATTCTTGATGAGCACTACCGCGGCGGCTAAGATGGGCATTCGTCCACCTGTCACCATGACCGCTAAGGTT
        CAGCCATCGCTAACTATTACACAGCTTAATCCCATCGGAAAACTGTCAGCTGGCGGAGGAAGTGGAGGACAAACAATGGG
        GCCGCAGGGCGTGGCCAGCATCCAGGCGGTGCCAGTGCCGAATGTCTCTGCCAGTGTGGTCAATTCAAGCTCGGTGACGG
        GTGCCACATCGGCGGCCGGTGGAGCCACTGTCCTGCCACTTACCATCAGTGGCAGGGGAGCGGGAGTGGGACCAGGCGGT
        AATATCCTCACGGGAACTCTGACGCCCATCAAGAACGCAAGCGGCATCACTTTGGGCAAGATGATGATGGCACCAGCTTC
        TTCTGCCCCTGGAGCAGATGGTTCCAGCACAAGCGGGGCAACAGTGACGGGCTTTCAACGCACCTGGAATCCTGTAGTTG
        CTTCACAGAGCCAGTTGATGAAGATCGATGAGAAGGGAAGTGCTGCCACAATCTACTACGAATCTATGCCAGCCTCCGCC
        TCCACAGGCGTTCTATCATTGACTACGACAACAGTGACGCAGAGCACCCAGGCGCAGGCACAATTGGTTAGCAGCGCCGG
        TGGCAGCTTGTCGGTATCTTCGTTACCCTTTGCAAGTCACGCGACTGCCGGAGCGGGATCAGGTGGCGGCGGATCGCAGG
        CTACTTTTACGGTGTTGCCGTCGGGGGCTGGTGGAACAGCCACCCGAACCATTGGCCACCAGCAATTGATAATACCAGCA
        GGACCAAATAGTGCGCCGCCGCAGCACATGGTTATTCCGCTGCATACGTCCGTTAAGGTGACCACGGGAGCGGGCAATCC
        GCAACAAGCAACTGCAAGTGGAGCACTGGTGTCCAGCTTTATGCGCAAGCGGGATGCGGAAGGTTCGCCAATACGGGCGG
        CTAAAAATCTAGGACCCACTTTGCTTTCAATGGCTAGCAATAACAGTGGACAAAACATGCCACCGGCTCCGGGCACCACG
        TTCAACATTCAGCCGGTGTCCGTGACAGTGCCTCAATCAGTTGGCTCTGGGCTGACCGTAGAGGCGCTGGCCAAGAAGGA
        ACGGGAGCGAGTCACCCATGGTGTAGCAAGTAGCGCCGCTAGTGTGCCTGCCACAGTTGGCCCCGTGAACTCAACGAGAA
        ATTCGAGGGCGGACTCGCCGGCTTCGTCGGACGGCTCAACTACAGTGTCGGCGAATTCCTCACCTGGTGTGGATCAGCAA
        TTACAGGACAGGATTGGCGATCAGCCAGCCACGGGAGGCGCTGGTGGGCGCGATAATTCCACGCATTTTAATCCCATTAA
        TGAGATGTACTCATCACACCAATCGATTCAGCAGAACCTTGGTCACTCCTCACTGGGAGCCCGCAGTGGTAGCAGTGCCT
        TTGTGGATGTGCAAGCACCAACGCCGCAGCAACAGCAGCCTCAGCAGGTGCCTCATTTGGTGGGATCGACGCAGATGCAA
        CAAGGAACGCGTATGAATGGTACTGGTAATAGCTCCAGCTCCAGTTATGACTGCTCCTCTAGGAAAAAGCCGCGACGATC
        GACCAATGACAGCCAGCACTCTACGCAGAGTCAAGCATCCTTATCGCTGCCACCTCCAAGTTCGGAGCCAACGCCGCCGG
        CTGGCGCTTCGTACATGCAGAAGCACAACAATGGAGGACTACTGGTGACAGCAGCGACCCCGGGTGTTGCTCCCAACAGT
        GCGCCAGGCGATGCCAACCACCGGAACAGTACACCTGCTGTGGCGGGCAACAAGGAGAACGCAAATCCCGTCGACTTTGT
        GATTCGTCGTCCGCGCAATTGTGCTTTGCTCAATACGTATAAGCCCACACATAAGTTGGCCAACAATCATTTTCATCGGT
        ACACTGATGTTAAGCCAAGGGAGGAGCGGCGGGCCACAGTCATTGATCTGGCCAATCAGCCAAATGTGCAGGGCAAAATC
        AATGGATGGAAAATTTATCATTTACGCTCGCAAATGGAGGACTTGAATGAATCGGAAGTCTTTAGTCTGGGCAGGCTGGA
        GACCATGCTGCAGGATCTCGAAAAGGACAAGGAGAAGCACAGCGAAATTGAGCGAGTCACTGAACTGCTAAAGGGAAACA
        TTCAACGCAGCAAGATTATTACCGATGGCATCAACGAGGCACAGAATCAGTTAATGAAGATCTTCGAGCATAAGCCACAC
        GTTTCTAATATAATCACCCGCTGCGCTTCGAAAAGGAATTTCAAGAAGCGCGAAAAGATCTAAAAGTAATTGACGAACGG
        AGATGGCCAGCCAAGTGTGTATTAATAAGTTGTACATTACCTAATTTAAGCAGAAATTATAGAATCCAAGATAATTACCT
        TAAACGCGATCGATTTGTAAGTCGTACAGCTACAAAGAAAACCAGCAATATTTTTTCAATTTATTAAGCTAGAAACACAA
        ATACAAAAACCCTCGAGTTGTATTAAGTAG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0075927
        4045
        FBtr0075928
        4159
        FBtr0114506
        4060
        FBtr0332043
        4015
        FBtr0332044
        4018
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0075661
        1294
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0075659
        1219
        FBpp0075660
        1257
        FBpp0112998
        1257
        FBpp0304353
        1209
        FBpp0304354
        1210
        Comments

        GC splice donor site postulated.

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG11006-RC
        Sap130-RC
        Secondary FlyBase IDs
          References (2)