Open Close
General Information
Symbol
Dmel\CG10969-RA
Species
D. melanogaster
Annotation Symbol
CG10969-RA
FlyBase ID
FBtr0075946
Feature type
Associated gene
Evidence Rank
Length (nt)
2348
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GTCACGCCAAAAAACAAATTTAAACGGAAGCATTGTATAACTGAGACAAAAAATTGTATTTGGGAAAAAAGAAGAAATGC
          CCAATGACGGAGTCAAGTCAACCAGGCCCAGTCCCTATTGGCGTCATGCGAGTCCTCCTCCGAGGAGGAACATAGCATCG
          GAGCAATACAGCAATCGAGTCGGACAGCAGCTGGTGCGAGCCCTGGCTCAGAGCTTACCGTCTGGACAGGAAGCCGTGCG
          TTCCCGATCATCCTGCCCACCAACACCTCGTCGTCGCCGGCAGGCAAGTGTCTGCAGATCGATGGGAAGTCCAGAGTTTG
          TGCCATTGATGTCGCACAGTAAGCCCAAGGCATCGGTTCGATTGAAGGCGGGTATGCCGGTGAAACCAGTGTTGGGAGGA
          GATCCACCCAATTCAAAGACTCCTGGTCAGTCTATGATGGCCTCAGCCAAACGTCGCAATGAATCCCCCACAGTGAAGGC
          AAAAAGCAGGGAAGAAGAGTTCAATAAGATACCAGAGCTGGTTAGTGAGGCATCCGTCGCCAAGGCCAGAGAAAAAGAGT
          TCGAAAAGATACCTTCCGGAGTTCCGAGTTTGACCGAAGAAAACAAGCAAACAGAAGTGAAAGACACAAATAATTCAATC
          CCGGAAACGCATGAGAACTTGAAACCGGAAACGAAAACCAATTTTATAATAGAGGAAGAAAAGCCCACAGAATGTATACC
          AGAAACGGAACCGAAGCCATCGAACTCGAAGATAATTCCCTGCTTTCGAGGAGAGTATCCCACACGACATCGTCCTGGTA
          CTTGCCAATGGTTTCAATCCGACGTCCCCAATTGCGGAAATATCGTGACCATATGCGATGAGGAACACCAAATTATGGGT
          GAAGCGGAAATAGTCACCGCTTGCCAGGTTACCGAAGCACATTTCCTCAGCCTCGATTGTGAAAATGATAACATGAACAA
          CGAACCGCCATCGATTTCGAGGTGCAATAAGTGCACGGGTTGTCCGCAGCAACAGAATGGTAATTGGTTTGGACAGCAAC
          GATCTTGTCCTCAGCAGCAACAACCTTGCTTTCAACAGCAACAACCGTGCTTTCAACAGAAACCATCTTGCTTGCAGCAG
          AAACCATCTTGCTTGCAGCAGAAACCATCTTGCTTGCAGCAGCAACCATCTTGCTTCCAGCAACAGCAACGAAATTGTGG
          ACGAAATCCACCCTGTCCCAATGTGAAACCAAAAGGATGTCTCAAGTGTCAGGAGCAGCAGCAGTCTGGCAAAGCATTTG
          CATACAATTTGCAGCAGTCGATGCAGCAGCAAGTTCTGCCGCAGATGCAGAATGTGTATCCTTGTCAGCAGCTTCAGCAA
          GTGAATACCTGTGATCAAATGGAACAACAAATGCAACAGCAAGGCATTGAGGAGAACAACTATGGCCTGACCGAAATGCT
          GGCCGAGGAGCTAAGAAAGCAAATGCTCGAGGCTCAGGCGCAGATTGCACAAGTGCAACTGCAGTTGAATAGCGCGTGTG
          GAGCCACAAGAGTGCGACAGATGCATGTGCTGTCCCAAAATGCCACTGACGTCCCACGTTGGGCGCCAGAAACTCAGTTT
          ATTGATGTACTGGCAGAGGAACACGACGTGGGAGATGCCCAACCAGATGAAACAATGGAAAACGGCGAAGAGGATCAGGG
          ATTTAACTCGCAAGTGGATCAGCATTCTTTGCCGGCTAGCTTTCCATGCCAAACCATCGAGTCCACCAGGTCGGAGACGA
          TTTGGACCATGCCATCAGCACCTCAGTCGTCACAGCAACAGATGCCGTTTGGTCTGTATCCTGTGCCACTATCGATGCCA
          AATCAGAATAACTACTTCCAGCAGAATCCTCAACAATTTCCTTGCCAAATGGCTCCTTTTCAGCAGCAGCAACAACAGCA
          GCAAATGGCTCATTGTCAGCAGATTCAGTCTTGTAGAGCACCACCGTGTCCACCCAAAAAGCCGCCTCCTTGCCAGCAGA
          AACATCAGCAGCAGCGATTATCCTGTCAACAACAGCAGCAACAGCCCATAAGATCTGGTCAACCAGCCCAGTCCAATAAG
          TGTTCTCATTCTCCACAATTTTGTCCCAGTTGTTGTTGCCAGCGCTATGCGCAAATGAGATTCATGATGCCCCGATGTTG
          GCTGCGCTAAAGATTTCGAAAAGTTCTAGGTTTGTGGGCGTAACTTATCTTGAACAGTCAACACAAATGTTTCTTCAAGC
          TAAGATACCTTACAAATACCAATTTGAACAGGAAGTTGTGCAATTCTTCCGTTTAAAATTGAGGCGAATAAATGAAATGC
          TTCGAATAAAGTTTGGATTTTAAAGCCT
          
          Other Products of this Gene
          Other Transcripts
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0075678
          697
          Derived from OTHER transcripts
          Comments

          Extended 5 UTR based on RNA-Seq and/or EST data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG10969-RA
          Secondary FlyBase IDs
            References (2)