Open Close
General Information
Symbol
Dmel\Plod-RB
Species
D. melanogaster
Annotation Symbol
CG6199-RB
FlyBase ID
FBtr0076188
Feature type
Associated gene
Evidence Rank
Length (nt)
2544
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 90 )
Sequence
TTGTTATTCGCGTTTCTGAGTTTCTTGCGGGTGGGACTCCCGATATTTTGTGGAGCGGAAGCGAGTGCTTCACTGTGTGT
GCGAGTAAGAGAGAGAGAGAGCAACTAGCTCCAGCATCATGAGAATACAACAAAGCGCCTTGTTGTTGTTGCTGCTGGCC
GTGACGTCGCAAGGAGATGCCGAGTCCAATTGGAATGACAAAATCAAAGTGTTCACTGTGGCCACTGAACCCACCGATGG
CTATACTAGATATATTCGATCTGCACGAGTCTACGATATTGAGGTAACCACCCTTGGCTTGGGAGAGGAATGGAAAGGAG
GAGATATGCAAAAGCCTGGCGGCGGATTTAAGCTCAACCTTCTGCGCGAAGCTATTGCTCCGTATAAAAATGAACCCGAA
ACAATCATACTCTTCACAGACAGCTACGATGTGATTATCACCACCACGCTGGATGAGATCTTTGAGAAATTCAAGGAGTC
TGGTGCCAAGATACTCTTCTCCGCCGAGAAATACTGCTGGCCCGACAAAAGTCTGGCCAATGACTATCCCGAAGTGGAGG
GCAAGGCCTCCAGATTCCTCAACTCGGGCGCGTTCATTGGTTATGCACCACAAGTTTTCGCTCTGCTGGTGGATCCAATT
GAAGACACTGCCGACGATCAGCTATATTTTACAAAGATCTTCCTTGACGAGACCAAACGCGCCAAGCTGGGCTTAAAGCT
GGACGTACAATCGCGCCTATTCCAAAACCTACATGGTGCCAAGAACGATGTGAAGCTTAAAGTGGATCTCGAGAGCAATC
AGGGCGTTCTACAGAACGTGGATTTCATGACAACGCCTTCCATCATCCATGGCAATGGACTTAGCAAAGTGGATCTGAAT
GCATATGGCAACTATTTGGCCAGGACTTTTAATGGCGTCTGCCTTTTGTGTCAGGAAAATCTTTTAGACTTGGAAGAGAC
AAACCTACCTGTGATTTCCCTAGCCCTGATGGTCACGCAACCCGTACCCTTCTTCGACCAGTTTCTGGAGGGCATCGAGA
GTCTGAACTATCCTAAGGAAAAACTTCACTTGCTCATCTACAGCAATGTTGCATTTCACGACGATGACATCAAGTCGTTT
GTAAACAAACATGCCAAAGAGTATGCTACTGCCAAATTTGCTCTTTCCACTGACGAGTTGGATGAACGCCAGGGCAGGCA
GTTGGCCCTTGACAAGGCTCGTCTCCACCAGAGTGATTATATATTCTTTGTGGATGCAGATGCGCACATCGACGATGGCG
AGGTTCTCCGGGAGCTGCTCAGGCTGAACAAGCAATTCGTGGCTCCGATTTTCTCCAAGCACAAGGAGCTGTGGAGCAAC
TTCTGGGGCGCTCTTTCCGAGGGAGGCTACTATGCCAGGTCGCACGATTACGTGGACATTGTAAAGCGGGAACTTATTGG
AATGTTCAATGTGCCCCATGTAACGAGCATATATCTGGTGAAGAAAACCGCCTTCGATGCCATCTCCTTCAAGCACAAGG
AATTCGATCCCGACATGGCCATGTGCGAGTCACTCCGAAATGCGGGTATCTTCATGTACGCCAGCAATCTGCGCATATTC
GGTCACTTGGTCAACGCCGATGACTTCAACACTACGGTGACACGTCCGGACTTTTATACGTTGTTTAGCAACGAGATCGA
CTGGACGGAGAAGTACATACATCCGAACTACTCACTGCAGCTGAACGAGAGCAACAAGATACAGCAGCCGTGCCCGGATG
TCTATTGGTTCCAGATCGTGTCGGACGCGTTCTGCGACGATTTGGTGGCCATCATGGAGGCGCACAACGGTTGGTCGGAC
GGCAGCAACAACGACAATCGGCTGGAGGGCGGATATGAGGCGGTGCCCACCAGGGATATCCACATGAAGCAGGTGGGCCT
GGAGCGGCTCTATCTTAAATTTCTTCAAATGTTCGTTCGTCCGCTGCAGGAGCGCGCCTTTACGGGTTACTTCCACAATC
CTCCACGCGCGCTGATGAACTTCATGGTGCGTTATCGGCCGGATGAACAGCCTTCTCTGCGACCCCACCACGACTCCTCC
ACGTACACCATCAACATTGCGATGAACCGGGCGGGTATTGACTATCAGGGCGGTGGCTGTCGTTTCATTCGTTACAACTG
CTCCGTGACCGATACGAAGAAGGGATGGATGCTGATGCACCCGGGTCGACTGACTCACTACCACGAGGGATTGCTAGTGA
CCAATGGCACGCGTTACATCATGATTTCCTTCATCGATCCGTAGGGTAGCTAATTTAAGTCGTACTCTTTATATCAAACT
GCCATATCGGCCACTCCAAAGAACTGCATACTAAGCCCAATGAACAATTTATGTTGATGGAATTGCGGCATCGGCCTTCT
ATTTCTGATGATTTTACATACTACTTTGAGATCGATAGCTTTAGGATACTCTGATGAATCTGTTGCAGCCTTAAGTTAAT
TATAAGCTTTTTTACCAAGTGCAAAGTGTTCAATTTTTGAATAAATTAATTCAATTATTAAATG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0076187
2630
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0075918
721
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0075917
721
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG6199-RB
Plod-RB
Secondary FlyBase IDs
    References (2)