Open Close
General Information
Symbol
Dmel\scramb1-RC
Species
D. melanogaster
Annotation Symbol
CG32056-RC
FlyBase ID
FBtr0076303
Feature type
Associated gene
Evidence Rank
Length (nt)
1640
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 8 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GCAGTTAGTTCATCTCTGTGCTGCAGAGCAGGCAGTCGTGTCAGTCTGAAAAAATGTCCACCGAAAACCCAGCAAGTTGT
        GTTTCCACGCTGGACCTAAGTGGTGGCGAAAATCGGGGAAATCCGGAGGAATCTCATTCCAGGGGCGTGAGGAGCGGCTC
        CAAGGTGCTGCGCTTAATCTGGCACTCGCTGTATAGCCAGTATAATCAGATCTGCTCGAGATCCCAGACTCTAAGGCAAC
        TGGTTTGCAGGGAAGCCAACAAACCACTGCCCAAGAAACTCAGGCACACAATGAGACTAAATAAGTCGGCCAAGCGAAAG
        GGATACGAGTTCTACATGAGCGACGAGGACAGGAGTATACCTACCGGAATTCCGAACTGTCCGCGCGGATTGGAGTACCT
        TACGACTATCGACCAGCTTTTAGTTAAGCAAAAGGTCGAGCTGCTCGAGGCCTTCACTGGTTTCGAGACCAACAACAAGT
        TCACGATCAAGAACGCCCTGGGTCAGAAGGTCTATTTCGCGGCGGAGGACAACGACTGCTGCACGCGCAATTGCTGTGGT
        CCTGCGCGTCCCTTCGACATGCGGGTCTTTGATAACTTCCAGCAGGAAGTGATCCACATGCACCGCCCGCTGGCCTGCTC
        CTCCTGTCTGTTTCCCTGCTGTCTGCAGAGTATCGAGGTCTCGGCACCACCCGGCAATGTTATCGGCACCATTGAGCAGG
        AGTGGTCCATCTGTTCGCCATCCTTCCGCATCCTCAACCACGTGGGTGACACGGTGATGCGCATCGAAGGACCTTTCTGC
        ACCTTTTCGCTCTGCGGCGACGTTGAGTTCAATGTTGTTTCGCTCACTGGTGAGAAGATAGGCAAGATCTCGAAACAGTG
        GTCGGGCCTGGCACGTGAAATTTTCACGGATGCGGACTTCTTCGGCATCAATTTCCCACTGGACTTGGATGTGCGCATGA
        AGGCCGTTTTGCTGGGTGCCACATTCCTCATAGATGCCATGTTCTTTGAGAAAGCCGGAAACCAAGAGACCGATAGGCCC
        GGAATGCTTTAGGAATCGGGTGCTGGCTTGTGCGTGAATTGTTTATGCGTTGCAACCGATTGTTGTGGCGTTTGTGGCAA
        TTGCGAATGCGATTGCGACGATTAAATGTTGTGCATTATCTTGAGTTGCAACTTTATCCAAATATCTTCCCGGTGAACTG
        TCGCGTACTAGTCTTCTGTACCAAATGCTTATTGATGAAAATGGATCGCACTAATGAAACTCCTTGTTAATTTTGATGAA
        CATACTGAACTCAGGCTTCCTTCGAGAGGACATTGCCAGAATATAAAACTAACTTTAAGTTAGCATTTTTTGCTATTTTG
        CCACAGCAATTACTTGTGTAAAGTATTCAACGACAAATCAGCTTTATTTATGAATTTTGTATTGATGCTCTGAAGCGACA
        ACTAACTAACGAATGATTCGTTATTGAAACATGTACTTTAAACTGTATGTTAAGTGTCTTATGGAAAGAAAAATATATTT
        AACATTGTATATTGTTAAGCATCAGGAAATTTATATATATCCCTACTGATATTATGGAACAGAAGGTTTTCTTTTTATGT
        ATTACAACAAAAGTTAAATAAATTATAAACTTATATACTG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0076301
        2049
        FBtr0076302
        1655
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0076032
        332
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0076030
        416
        FBpp0076031
        233
        Comments

        Splice acceptor site (intron 1) not supported by EST or RNA-Seq data; supported site introduces frame-shift or necessitates use of downstream translation start site(see alternative transcript).

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG32056-RC
        scramb1-RC
        Secondary FlyBase IDs
          References (2)