Open Close
General Information
Symbol
Dmel\Ae2-RD
Species
D. melanogaster
Annotation Symbol
CG8177-RD
FlyBase ID
FBtr0076322
Feature type
Associated gene
Evidence Rank
Length (nt)
4668
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 44 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    CCTCATTTGCTGGGCAGCCTTCCCAGACAGCGGAGCTGGCCAATATTTGGCCTCAAAAAATAGATATTTATATATATATA
    TATATGTATATATACTCTCCTCATAACTCGCGGGTCAAAAGTGCAACAGACAAAAAGGATTTTGCGTGAGGGAAAAACCC
    AATTACCAAACACTAGCAAACGTGATCGAAAGTTTTGCAAGCAAAATAGGAGCCCTCAAGTCTGGCAATGAGGATCCCGA
    CGAGGTGCTGCTGGACTCGGAAATGGACAAGGTCTTTGCCGGCAACAGTGCGCGCAAGGACAAGTTCGATGTAAACACCT
    TCCAGGACAACTCCCAGCTGCCCATTGGATCCCGCAAGAAGAATAGCATCCGCACAAACGATCTGAACATCGAGGAGGAC
    TCGGAGTACGAGAGCCAAACGGAGCCATTGAATAATGCACAAAACTATGATGACATCCCCGAAGACTTCCCGCTAGTCTC
    GGAGAGAGCCGGACACGGCGATCACTCGGACAACTCGGTGGACGAGAAGCACGTCCAGTTTGGCGGCAAAAAGAAGATCC
    CGCCCAGTTTGAGCTATGATGAACAGCCCACGGACCAATCGCACGAACGTAAACGCAGAAGAAGCCGCCATCAGTATTAT
    AGACAACGTAAATTCTCACATCAGGACAGCGTGGAACCCAAAAACAAGCTCGAGGAAAACGGTGATGCAGGTGCGCGTCG
    CATCTCTGTGCAGCCTGAGGACACGGCATTGGAGGAGGCTGATCTTAACGAGCTGAGATCACATCGTTCGGACGACCCGC
    GTGCCCTGCGCCGCCATAAGATCCATCACTCATCCATCAAGTTGCGCGAGTTGCCCCAAATAACGATTTCCCCCTTCACC
    AACAAGAAGCCCGAGGTGGATCATAGTCCTCATGAGATCTTTGTGCAATTGGATGAGCTCACAGGCGTGGGCGAGGATCG
    CGAATGGAAGGAGACGGCCCGTTGGATCAAGTATGAGGAGGACGTGGAGGAGGGCTCCGATCGTTGGGGCAAGCCCCATG
    TTGCCTCCCTCTCCTTCCACTCGCTGCTCAATTTGCGTCGCTGCCTGGAAACGGGCGTTGTCCTGCTCGATCTTAACGAG
    AAGGACCTGCCTGCCGTGGCCTATCGCGTGGTAGAACAGATGGTGATCGAGGACCTGATTGACATCAATGACAAGCCATC
    GGTGATGCGTTCGCTGCTCCTGCGCCATCGCCATGTCAACGAACACCAAGGTGTGCTGCCCTTCACCAAGAGGAAGTACA
    ACAGCTACACCAGCCTGCAGAATTTGTCTGGCACGGATGACAAGAAGATCAAGATTATGCCGGCCGCCGAAATTGGTGGC
    AGCAAGCGCAGCAATGAGCTCAAGATCGACATGAAGGACGATATGTACTCCTCGTCACAGGAGGATCTCAAGAAGCTGCA
    GAATGACACGATCCTCAAGAGGATTCCAGCGGGTGCTGAAGCCACCACAGTGCTGGTTGGTGCCGTAGAGTTCCTTGAGC
    AGCCTACCATTGCCTTTGTCCGTTTATCGGAGGGTGTCCTGATGCCCACATTGACCGAGGTTCCTGTCCCAGTAAGATTC
    ATGTTTGTTCTTTTGGGACCTCGTAACTTCGATTTGGACTACCATGAAGTGGGTCGTTCTATCTCCACGCTGATGGCTAA
    CGAGCATTTCCACTCCATTGCCTACAAAGCTGATGATCGCAAGGATCTGCTATCAGCCATCAATGAGTTCCTGGACGATT
    CTATCGTCCTGCCGCCCGGTAATTGGGATCGCCACGATCTCTTGCCCTTCGAAGAGTTGAAGGCCAAGAAGGATTGGATT
    CGCACGCGAAAGATTAAGGCACTGCAGGTGAAGCGAGACAGTGAGATGATTAAGATTGGCAAGGATGAGGAGAAGGCATT
    GCTGGAGAAGCAAACACTGGGAGCCATTGGATTCACGATTGGTGGAGGAGATGGTGGTGGTGATGGCGACTCCGATGATG
    ACAATGGCCGAAAGAAGAAGAAACCTAGTCCGCTGGAGAAAACTGGACGTCTGTGGGGTGGTTTGAGGAACGATCTTAAA
    CGCAGAATGCCCATGTACAAGAGTGATATACTCGATGGCCTGAACACCGAAACCCTGGCTGCCACCATCTTTATGTACTT
    CGCTTGCCTCTCAACGGCTATCACATTTGGAGGTCTCGTTTCCGCTAAGACAAACAGCTGGATTGGTATCTCAGAGACTC
    TGATCTCGTGCTCCCTGGTGGGCATTGTTTTCCATTGTCTGTCCTGCCAACCACTTGTGATCATTGGAACCACCGGACCA
    CTGCTTCTATTTGACGAAGCCCTCATGGTATTCTGTACGCAACATGAATTCGATTTCTTGTCCCTAAGAGTTTACGTCGG
    AGTATGGTTAATAATAATAGCCCTAACTGTATCCGCCTTCGAGGGCAGTGTGTATGTTCGTCTGCTGACGAGATTCACTC
    AGGAGATATTCTCGGCTCTGATTACGCTCATCTATATTGTGGAAACATTTATGAAACTGATTTCGATCTATAGGGAAAAT
    CCCCTGCTATCTGACTACAATCTCCCTCCGCCGACATTGGTCGCCCACGAACATGCCACCAATGAAAGCCTACTCAATGC
    GACGGCGAGTGTTACAACGAATATTACGCAGATGGTAATGAACATTTCAACAACAGCCATGCCCATTGGTCCACCACCAT
    TGCCCAAGAATCAGCCGAACACCGCTTTATTCTGCACCATCCTCACATTGGCCACTTTCGTGGTTGCCTACTACCTGAAG
    CTCTTCCGTAATTCCCACTTCTTGGGTCGTAATGCTCGCCGTGCCCTCGGTGATTTCGGTGTACCAATCTCCATTGCCAT
    ATTCGTGCTGGTGGACTACCTGGTGCCGGCTGTGTACACAGAGAAACTGGTGGTTCCGGAGGGTCTGTCGCCCAGCGATC
    CCTCTAAGCGCGGCTGGTACATCGGTTTCGATACCTCTTCCACGTGGATACCATTTGCTTGTGTGATACCTGCCCTGCTC
    GTCTACATTCTTATCTTTATGGAGTCACAGATCTCCGAGCTGATTGTGGACAAGCCTGATCGTGGCTTAAAGAAGGGTTC
    TGGTCTCCACTGGGATATTGTGCTGCTTTGCCTGCTCAACTGCGCTTGCGGAATATTTGGAATGCCCTGGCATTGCGCCG
    CCACTGTAAGATCGGTGACTCATGTGTCATCCGTCACCATTATGTCACGCACCCACGCTCCTGGTGAATCGCCCAGGATC
    GTTGATGTTAAGGAGCAGCGCTTGTCCGGATTCTTTGTGTGTCTGATGATTGGACTATCGGTGCTGATGGCTCCGCTTCT
    TCGGTTGATACCCATGGCCGTGCTCTTTGGAGTCTTCTTGTACATGGGAGTGGCCTCCATGAGCGGAGTGCAGTTGTTCG
    AAAGAATAAGACTGTATTTCATGCCGGTCAAACATTATCCACCCACATCATACGTGAAGCGATTGCGTCCTTGGAAGCTG
    CATTTGTTTACCACCATTCAGGTGCTGTGCCTGGTACTCCTCTGGAGTGTGAAGTCGTCCCAATTCTCGCTGGCCTTCCC
    CTTCTTCCTGATCATGATGGTGCCGATACGGCAAAATTTGACAAAATTGTATAAGCCAGAGGAAATGCAAGCGTTGGATG
    GCAGCGAGATGAAGAAGAACGACGACGACGAGCCCGATTTCTATGAACAAACCAACATACCAGCATAGGATTGCATTGTT
    GGGAACTTAATTAGTGTTAGATTGAAAGTATTAAAGCCAAGCCAAGTTTTACGCTGGCCCAAAAAGAAAAGAAAATCACA
    ACAGCAAAAGCAAGGAAAAACAAAACTATAACAATACAAATACAAATACGATATATTTGTTGCGACATTCTGGTGTGAAA
    GCGTTAACGAACTACCTGCAATTAGAATTTAGAGACAAGCCACACACAAATCTACACACACACCTGAATCACCCAGAGCA
    TATATATAGCATTATACATATTTGTATAATATATTTGCGGTGTCTGCACTTTTGTGATTGAAAGCGGTTGAAGCTGCAGA
    AGAAGGCGGAATCGTGTACCTAAATTGCAACTGAAATCAAGAGACAAATTAGATTATTAGCCAGAATGACTTGGTGGAGC
    AGAGAACAAAAATCATATTTTTGAGGCCAACAAAATCGGTTGCTGGTATATCAAATTTTAGCATCGTTACCTCTGACTTG
    TCAGAATTAGACAAATATCCTTCCCACGGAAAGGAGCGTCACACAATGATTGCATCACACGCAAAAGAAACCAACGAGCG
    GAACAAGTTATTAACTCGGTTGGAGACTCGCATGTATTATTAGCAATAATTGCATTTGCATATACACAAAACTATTATAA
    ATTTGGCTTAGACCTATCAAATCGAAGCAATCCCAGCGTGGAAAACTAAGAGGAACCCGTAAACTATTTAACTTCAACTG
    GCGTAGTGATAATTAGTGTCAAACACACACAAAAACCTCCCCTTTAAGATCGAACGAACAATTGTTTATAACAAAAAAAT
    CGTTTTAAGCACTTCAACCGGAGCTTTCTTTTAAAGTAAATGCTTCGCGTTTGAAGTGGCCGCTGTAAGTTTGCCTTCTT
    TGTACTTGTAGTCAGGATATTGAAAAAC
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0076321
    5144
    FBtr0076320
    5173
    FBtr0076317
    5319
    FBtr0076323
    5099
    FBtr0076318
    4515
    FBtr0076319
    5759
    FBtr0076324
    4869
    FBtr0076325
    5043
    FBtr0076326
    4994
    FBtr0076327
    4965
    FBtr0301228
    1450
    FBtr0331848
    5620
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0076051
    1161
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0076050
    1268
    FBpp0076049
    1201
    FBpp0076046
    1201
    FBpp0076052
    1228
    FBpp0076047
    1201
    FBpp0076048
    1268
    FBpp0076053
    1201
    FBpp0076054
    1201
    FBpp0076055
    1166
    FBpp0076056
    1233
    FBpp0290446
    371
    FBpp0304232
    1210
    Comments
    Transcript terminates at site supported by polyadenylated cDNA.
    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (2)
    Reported As
    Symbol Synonym
    Ae2-RD
    CG8177-RD
    Secondary FlyBase IDs
      References (2)