Open Close
General Information
Symbol
Dmel\CG5021-RA
Species
D. melanogaster
Annotation Symbol
CG5021-RA
FlyBase ID
FBtr0076513
Feature type
Associated gene
Evidence Rank
Length (nt)
933
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 14 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GCGAAAACGATAGAAGGCTACGCAGGCAGAAACAACAACAACGTCCCAGGCGAAGAAAATATATTAAATCCCCTGAAAAA
        CCACGAAAATCCATGAAAATTGCACCCAACTAGGAATTAGAAGTCACTCCCTACACCAGCATGGCATCCGCTACGGTAAG
        AAATGTGCCGCTGCTCGACGATGACACGATACCCTTTGGCGAGGAGGACGAGATGCGGGATCCCAGTCGCGCGGGTCAGA
        AATACACGCACCCGTACGTCACCTTCTTCCACCTGTTCTTCAGGGGCGCCGCCATCCTGATCTATATGTTCTGCGGTTGG
        TTCAGCGACTCCTTCATCACCAGCTTCGTTTTCGTGGTGCTCTTCCTGTCCGCCGACTTCTGGACGGTGAAGAACATCTC
        GGGCAGATTGCTGGTCGGTCTCCGCTGGTGGAACTACGTCGACGACGATGGCGTATCGCACTGGGTGTTTGAGTCAAAGA
        ACAGTCGGGTCAACAAGAACGAGCAGCGCATCTTCTGGCTGGGACTCATCCTCTGTCCCGTCTTCTGGGGCCTCTTCTTC
        CTGTTCGCCCTATTCGGCCTGAAGTTCAAATGGCTACTGCTGGTAATGATCGCCATTGCGCTGAATGCCGCCAATCTGTA
        TGGCTACGTCAAGTGTAACTATGGTGCCAATAAGGATCTGAATTCCGCCGCCACAGACTTTGTGAAAACGCAGTTCTTCA
        AGAATGCCGTGGACATCATGACAAGGCCCAGTGGCGCCCCACCGCCAACAAATGTACGCCCGACGGGAGTCGTTTGAGCT
        GGTGGAGACGCCATCTACTAAGTCACCTTGCCACCGTCTGCTGCAGCGCATTCCAAAGAGTATTCGACGCTTCTTCTGGC
        GCGGACCACGACCTTCGATTGGCATCGCTGTCTGTGTACCATATGTAAAACTT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0076514
        1007
        FBtr0301139
        1088
        FBtr0301140
        1022
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0076240
        218
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0076241
        215
        FBpp0290362
        223
        FBpp0290363
        220
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG5021-RA
        Secondary FlyBase IDs
          References (2)