Open Close
General Information
Symbol
Dmel\ImpE1-RA
Species
D. melanogaster
Annotation Symbol
CG32356-RA
FlyBase ID
FBtr0076606
Feature type
Associated gene
Evidence Rank
Length (nt)
6043
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 48 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CTCTTCAGTTCGTTGCTGACCATCGTTACGTGCGGACGTGCCCAGCTCAGCTCATCTTCGTGTGATGTGGCTGCACTTTG
        CACACTAAACTTAAGATCTGAGCCCAAAACGTTTTCCAAGCTGCAAAAATATAACAAAAGTGCCGCGACGCGTGTGACAA
        ACGAAAATCGAGTAAAACGCGAAAAACATATATTTACGACTGCAACGAGAGGAATACCAGCTACAGGAAAATAACCCAAG
        AAAAGCGGCTGAAAAATCGAAAAAACCAAAAGAAAACACACAAAAGGAGGGAAAAGCGAGAAAAGCCTTCCCAGGGAGAT
        CCAAAGCAGCTTCTTTGGAGATTCAGAAGCGGCAATGACGGCGACTGCGAGGCAGTCGGCAACATCGAGAAAGCAACCTG
        CGATCGCAATGCTCAATGGAAACGCTTTTACGGTTAAGCGGCTCTTAGCGCTGCTGATCATCTTCACAGTGGTGGACGCG
        AGTCGATCCCTGGAGCTGGGCGACAAGTGCCAGCATGACATGGACTGCACGGATTTCATCAAGGGCAGCAGCTGCTCCGC
        CCTCGGATACTGCGAGTGCGCCCCCTACTTCGTCCAGTTGGATTCCAAGCGCTGTTTGTCATCCCAGCTCCTTGGCGGCG
        ACTGCCAGCTGAGCGAGCAGTGCTCCATGAAGGTGGCCAATAGCAGTTGTCTGGAGGGTGCATGCCGCTGCGTCGAGGGA
        TTCCTGCAGTTCCGCAAGCACACCTGTCTGGGACCTGCCCATCCTGGTGCCGTTTGCTACAGCCACGCCCACTGTCAAAT
        GTTCGACACCCGCACCCACTGTGACTTCCTCATCCCGAATCTCTTCGGACGCTGCCAGTGCACAAGTCCAGCCAAAATGG
        TGGGTGGTCTGTGTGTGGCCCCGGCGGCGGATCAGGAGGATCAGAAGCAGGAACAGGCCGTGGAGAAGGTAGAGCAGCCA
        GCTAGCAGTACCACTACCACGACGACAACAACAACCACTCCTAGGCCCACAACTAGAACCACGAGTAGAACAACGACGAC
        CACCACTGCAGCACCACCAACAACCACCAGAAGAACAACAACGACCACAACTACGACAACTCCAGCGCCCATTCTCCTAG
        AAGATGAGCTGCCCGCCAGCGTGGAGGAGCAATCGCTGGAGGAAGACGATGGTGAGACCACCAAGCTGAGACCCGAGGTC
        GTTGAGGTTGATAATGGTGAAAAATTGGAGGCTGTGGACCTGGCTCATGAGGAAACCGAACTGACACAGCAGCAAAATCA
        ATTAGATGAGCAGCAACATCAGGAGGAGGAACAGAAACATCAAGAGGAGGAACAACATAGGATTGAGCAGCAGCAGAACC
        AAGAGGAGGAGCAGCAGCAGCAGCAGCATCAGCAGCAGGTCATAGACCAAGCAAGCGACGCAGAGCTTCCTCAATCCTCC
        CAAGATGCCACCACTGGAGTCCAACAGCTGCTCACACCTGCTGATGTGCCAACCGAGGATGCCATTAATGCGGAACAGGA
        AACTGAGGCTGGACCCACTGAAGATTACCCATACAAGATCGATGAGGAGTACACAGAGGAGCACAATGACAAGCCAGAAG
        CTCCAGAACTGACAGTGGATCAACCTGAGCACGAAGAATCCCCAGTAGCCACTGAAATCGTGCCTATCGAAGCGGATGAG
        GAGGCTGCTGAGGCCTCGGGTGGTCAAGAGATTGCCTCATCGCCCATCGACGATACCATGAAATTCGATTATGAAACATC
        AGTGGATGATGTTGAGCCAGCCAAGCCAGAAGATGAAAAGGAGACGGAGGCAGTACACCAAGCGACTAATGAGGGGGTGG
        TGCCCATTGATACCGAAAGCGAGACTGATGCAGAGACTAGCACCGAGCCCCAGATCCAGACGCAGCTGCTGCAGGAGGAT
        GGAGAGCCAGAGACATCGCAGACTGTGGCCGATGAAGAACTGATCCCGGTTAATGAAGGTGAAACCGAAAGTGTGACGAA
        GGCAGCCGACGAGACCGAGGAGATACCGGAGGAGGAAACACCTGAGGATCTGGCTTCGGGAGATCATGAGCTGGATGTTG
        CTGCAGCCAGCCACGATGATGAGGTGGAGACGCCCAAGCAGGAGGAGCCAACAGAAGCGTTGAAGATCGAACAGCCAGCC
        CAGGTGGAGAGTGAAAGCCAAAACGTCGACGAGGTGGGAAAACCAGAGGAGCCACAGGCCGAAATGGAAATAGAAAAAGA
        AAAAGAAGAAACGGCAGCGACCGAAGCCGCAGAAGTGGAGCTGCCGGCCACAGAAGCCAAACCAGATATGGAATCCGAGA
        TCGATCAGGTGGAACAAAGCGCCGACATCAAGCCGACAAGTGGCGAAGATGATTTAAATGAAGCCAATCAATTAAATCAA
        GACCAAGTCACCGAGCCAGCCGCTCTTGAACAGGAGGAGATCGAAGAAAAAGAGCCCGAGCAGGTGGTGGATATGCATGA
        AGATGCAGATGAAGCCACAACGGAGAAACCAGTCCAAGATCACGACCAGGAGGAGGTGGAGGCAATCACCGAAGCGGAGC
        ACGGACAATTGACATACCCAACAAATGATGATGAATTGGCGCCAGTGGAAATAGAACCAGAGCTGACCACAGAGGAACCA
        GAAATCGCTGAGAACACCACCGAGCTGCCCGAGCAACAGCAACAGCAGCAGGATGAGGAGGAGATTGAAGAGGCGGCACT
        TGCACATGAGGAGCAGGTGCAGCAGGTGGAGCCCGAGGAAAATGCAAATGCAATTAAGACGCCCGAAGTGTCGGAAGCAA
        TTGCAGAGCCCCAGGCGGATCTAGAAACCCCGTCAGCCACCGAGAAGGAGATCGAACCACAGACAGCGGACCATGTTGAG
        GAGGAGCCAGTGGCGATAACCGAGCGCATTCAAGAGGCAGAGCCAGAGCCAGAAATTGAGCCCACTAATGACGAGGTGTC
        GCAGGTGGATGCGGACCAGGCCGAGCCAGAGCTGCCAATTAAGAGCGATGCCGACATCGCGGAGGAAGCCGCCGAGGAAC
        CTGCTCAGACGGAGGTGGCTCCCGAAGTGGAAACGGAAACCGAGGCCAGTGAAAGTGCTCAGACATCTCCAGAGATTAGC
        GTAGAGCAAGATGAAGTTGCGATCGATAAAAACGAGAATGACAACATTATCCAGGGAGCCGAACCCAATGAAGAGGACGA
        ACTTATCCCGGAACCACAACCAATGCCAGAAGAGGAGGAATTGCCAGTTCAACAGGAAGCATCAGCTGTTCCGGAGGATC
        ATAAGTTGACCAAGCCAGAAATGGACTATACCAGCGTGGAGCATCTACAGGAACTTTCCCGGCCAGAAGAAACGACTGCT
        GCTATTGAAGCTGAAGAATCTGACTCTCGCGAATCCACTCTGGCTCCAGAGGCTCCAGATGCACCTATTGCCATTGTGAG
        CGAGGAACGCGATCCCGAACATGATCCTCAGAACTTCCATGAGAGCGAGAGCATTGCTGATATCCTCAGCGACTTGATGT
        TGGAGGCTGACAGCACTGTGCCTCCTGTTCCATTTGGTCAGCAACCCGCCCAAACGGTTCCCATGGTGGAGGCCAACTCG
        GAAAACGAGGAGGAACAAGCACATGAAGCCATTTCGGATCTCCAGGCTGAAGCCGATGAGACCCAGGAACATGCCGAGCA
        AGTGCAACCGGTTAACGAGCCAGGAACTGCTATTCCCGAACTGTTTGCAGAGGCAGCTAAGGATGAAGAAGATGTCCCAG
        CTCTCCCAGAATCTGATGAATCGAAAACCGAACAACCAAGCGCTCTGGAGGTGGAGCAGCACATTGCCAGTGAAGCGGAG
        CAAACGCCAGTGGAAGATGAGCACCAGTATGATGAAGAAGAGCACCAGCAGGATCAGGAGGAACATCAGCAGGATGAGGA
        CGAGCCCCTTAAGGAAGTAGAAACCGAATCCCTGCCAGAAGAAGCCACCACAGAAAAGTTCCAGGAGCCCGAGCCCGAAG
        AAGTTAACACTCCGTTGCCCGAGGAACTGCCCTTCGATCTTACAGATCACTCCGATGTGAACCGCTTCAATGAGCTGCAA
        TCCGAAAGTCTAATTCTGGAATCCACTACCAATATCGATGGTCTGCAGGAGCTGGACAACAACCATATTGAGGAAGAGGA
        GCCAGCAGCTCATGCCATTCCACATGAGGAGGCCACACCCAATCCCGCTGACATTGTCGAGATCACCACACAAACCATGT
        TGGGCCTGGCCAGTCGTGTGACCCTTATGGAGCCCGCTGCTCCCGTCGTTACCACGCTAATGCCCCTAATGACCGCCGAT
        GAACCCACGCCGGAACCCGTTTCTCCAGCAGCCATTCCTTCCGCCTCTCTGGCTGCCATCAAACCCGGTACGGAGTTGCG
        CAAGCGCGTGGATTTGGGTCTGGAAGCAGTTTCACTTGGATTGGCCTGCAGCAGTGATCGTCAGTGCCAGTTGGCTGATC
        CCCACACCGTGTGCAATAGACGAGGAGTCTGCGATTGTGCTGCCGGAGAAGAGGGATCACAGTGCAGCGCCGAGAGAACC
        GGATGCAGTCCGGGAACCTTCCAGTGCCGCTCGAGTGGCGTGTGCATCTCGTGGTTCTTTGTGTGCGACGGCCGCGCCGA
        CTGCAATGACGCCTCCGACGAGGAGTGCACCCACAACGCCCGCCTCAACCAGACCTGCCCCACGGAATCCTTCCGCTGCC
        AGCGAAGCGGTCGCTGCATCTCGCGCGCTGCGCTGTGCGACGGACGACGGCAGTGTCCACATGGCGAGGACGAGCTGGGC
        TGCGATGGCAGCGTGAAGGGCGGCAACGCCTGTCCGGAACACACCTTCCGCTGCGGCAGCGGCGAGTGCCTGCCGGAGTA
        CGAGTACTGTAACGCGATCGTGTCCTGCAAGGACGGCAGCGATGAGCCGCCGCATCTGTGTGGATCCCGCGCCCTCCCCA
        ACCTCTTCATGCGCCTCATCGAGGCGGGCGGCCTGCTCGGCGGTGGTCGGCGGGAGGCGGACGCCTACTGTCCGCACCGC
        TGCAGCAACGGACTGTGCCGCTCCACGGCCATCGTCTGCTCCGGACGGGATGGTTGCGGTGATGGCACCGACGAACAAAC
        CTGCTCCGTGTGCCGCTGTCCCGCCCCGACTGCTGCCAGCCTGCCCGCATTCTTGGCCCGACAACGCCCCATGCCGCTGT
        GGTAGGCGACTGCGCCACCTGCACCACTCACAGCATATGCACTCCAACCACTTGCGGTCACCATTTCGAAATCAACTGAT
        TGATTGACCCGCTCCTGTCTTCCGAAACCTTCGAATCTATCGCTTTACCCAACCCAATATTCGAAAAGATTTTTGCCTAG
        CATTTAAGTGGATATTTAAAAATTATTTATTTATTTATTATGACCTTAGCTGCGCCCTTGCCACGCCCAATTGCCACCTT
        GCTATCAAAGGGGGTTTTCCCAGATTCCCTTTGAGCCAGTGATGTTTGTCAATTGAGCCACTGGGCACAACCCCAATCCA
        CATATGACACCACACGCCACAAAGGACACACCACCACCCCACCCACACTTCGCCCCCATTTCGACTATTTATTCTACTCA
        TCTAAACCATCAAAACTATTTATTTATACCCCCTCCCCCACAAACAGACACTGAAAAACACTCGAAATGAATTCTTCATT
        TAGCTTAGTTTTATGCAATTTTTTAATTTATTTAAATTATTGGCCAGGCAAACCAGTAACCGAAAAAAAAAAAAACGAAA
        CAAAAACGAAAACGAAAACCATGAAATGATGCATTTTTATCGATTAATATTTTGTAAATAAGAGTAAACGTGTTCGATGT
        ACATGATAAACGACAATGCCTATAATGAAATGAAACATAGAGTATCCAACATAAACAATCCGATCATATCCCCTATATAG
        TTTATTATATGTACGTGCGTGTGAGAGACACTCACACACTTTTCTCACAGTCAAGACGCATCACAGTAAAACTAAAAAAA
        AAATTAAACAATAATAAAAAAATATATTTTTAGAAAACTATTG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0076607
        919
        FBtr0333057
        6099
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0076333
        1616
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0076334
        146
        FBpp0305271
        1616
        Comments
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (3)
        Reported As
        Symbol Synonym
        CG32356-RA
        CG7116-RA
        ImpE1-RA
        Secondary FlyBase IDs
          References (2)