Open Close
General Information
Symbol
Dmel\Nulp1-RA
Species
D. melanogaster
Annotation Symbol
CG7927-RA
FlyBase ID
FBtr0076684
Feature type
Associated gene
Evidence Rank
Length (nt)
2388
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 68 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CACAGAGCTCGGCAACCCTGCAGCCGTGCGAAAGCGAATGTGGTGAAGAAAAAAAAAACAGCGAAATACACACGTATTTT
      GCGACGAAATTAAATAGAATTCCTGCTAAGGGGTATAAGGACACTTGAAGGATGTCTGCGCGAATGCTGAAGAAGCTGCA
      GGGCGACGCTGACAAGCTGGCGCCACCGCCCGATGACGAGGACTGCGAGGAGCTGAGCGACAATGATGAACTGGAGGACA
      GCGATATGCAACGCTATCGAAAATCACACCTTAATCCATTCGATTTGCTCAATCAAGCCGGTTTGAGTCTCTCGGAGAGT
      GAGTTCAAAGAAGATGACAATGAAACGGAGCATCCGTCTGCTGCCCTGCCCAATGCTACTGCCAGTGCGGCCAAAAAGAA
      GAAAAAGAAGCGCAAGAAGAAGGCCAAGTCCAGTGGGAATCACATCAGCAGCGAAGATAACGAGCGTCAGGATAAGTACT
      TTGAGAAGGTGGATCCGCTCCTTGGCAAGGTCTACGATGCGGTGCCCAGACAGTCGGCGAAACAGTTGGTATCGGCTGCC
      ACCGGGACTACTGCCACCAAGAAACTGCTGGCCGTAGAGCTACGGCACCTGAATCCACAGAACGAGATGCGTCGCACTTT
      TGGCAAGCGGGTGGTAAAAGTGGAAACCAAGCGTGGCAGGCAGAAGCCCACGCTGAAGTCCACCTATATGGTGACCGCCA
      AGGATTCGTGGCCGGCACTGACTAAAAACACCATCACGATGAAGCTGCTGCCCGCCCCAGACTCTCCATCGGTGTCCTCC
      AAGTCTATCACAGATAATGGAGCGGACGTTCAATGGTTTGCCTTTGAGCATAGCCAATACTACCAGGGAGTGCAGCAAAT
      GTTCCTTTCTGCTCTCGAGCGCATTGACTCGGAATTTCTGATCACACTTATCAAACGCTGCCCCTATCATGTCGACTCCT
      TGGTTCAACTCAGCGAAGTATGCAAGATGACCGAAGACTTTTCCTTGGCCTCCGAACTGCTTGAGCGCGCCCTTCTCCTT
      CTGGAATCGTCGCTGCACATCAACTTCAGTTTGACGTCGGGCAACTGCCGACTGGACTACCGGAGACAGGAAAACCGATC
      CTTCTACATCGTGCTGTTCAAGCACGCGCAGTACCTGGAGGAACGAGCTTGCAGCCGCACCGCCTTCGAGATCTCCAAAC
      TGCTCCTGAGTCTTCAGCCAGACACAGATCCTCTTGCCATGATTCTAGTGATTGACTACTATGCCTTGCGCAGCAAGCAG
      TTTGAATGGTTGGTAGAGTTCTATGAAAAGTATAACGCCGCGAGGAACCTCAATCAGCTGCCCAATATGGCCTACTCGTA
      TGCTTTGGCTCTACACACGCTCTATGGCGCTTGTGAACGCTCTAACCAGGCACTGCAATACGCCCTACTAATGTTCCCGG
      GTGTTTTACGTCCTCTTTTGGACGAGATGTCGGTGCAAACGGACAAGAGGGTCCTGGCCTCATCGTACTTCTTTGCAGAT
      GTGTCGGGCAATCAATCGCCCGCCCTGCACCAGCTGGTGTGCCTGTATGTGTGCCGTGCAAGAGTCGTTTGGCGTCAGAA
      CGAGGTGCTACCCTGGTTGGAATCCAACGTGAACATAGTGTTAGATCGCATTGAGAGTAAGGATCCCCTGGTTAATGAGT
      ACAAGGAGAAGCGATCACTGCGATATAGTGGAACACCACCAAGGCCCATTCTTCGACATGTCATACTCTCCGATTACAAG
      GAGAAAGTTCCACTGGCGGTCTTCGTGTCCAAGGAGAAGCAAGCCATTATGACCTATGATCCACTGCCGCCACCGAACAG
      CGTCAACTGCTATCATCGAAAATCTTCGTCAAGCAGCAGCCCCACAACGAACACGAACAATTCTGTGTCAATGTTCTTTC
      AATCGCTCTTGCCTTCGTTTAACATTAACAACCTAGCTGCAAATGCTCAGCTACAAGAAGGAGCAGCACCAGCAGCAGGT
      GCGGGAGCAGCTGCAGGCGATGCTAACATTGAAGTGGGCATTGAACAAGGAGCTGCCGGCGTAGCTGGCGAAGGAGAAGA
      AGCTGGTTTGCAGCAGTCATTAACGCTAATGATGGACGCGATGCGAGACTTCCTGCAAAACTTCCGGATTGCAGAGCACT
      TGCGTTCGCCGGAAACGGCGGCGGCACAATCCACGAGCAGCAACGACGAGGAGGAGGGCTCCAGTGACTACATTGACTAG
      TCAGTTTGTCAATTACGCGAGGCGTAACGAAGTTGTTTCGGATTTCTAGCTCGGGACATGTTTTTTGGAAACCACCTTTT
      GCTATTTTCTCAGCTTAGCGACACCGTCACAAAATTTATATATACAATACATAGAGCAATTTGAACAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0333949
      2618
      FBtr0334615
      2474
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0076407
      702
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0306074
      653
      FBpp0306682
      702
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG7927-RA
      Nulp1-RA
      Secondary FlyBase IDs
        References (2)