Open Close
General Information
Symbol
Dmel\CG14823-RD
Species
D. melanogaster
Annotation Symbol
CG14823-RD
FlyBase ID
FBtr0076908
Feature type
Associated gene
Evidence Rank
Length (nt)
1108
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 4 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GCCACAGAGTGTTCCAGCTATTCGCTTGGGTTAGTCGGTTTGCGATAGCAAAGGGAGAAGCCAGCTCGCCATGGAGCCCA
        CATGCAGCAGCAGTGTGGCGGAATTGGCCAAATACAGTGAGGATGATGTGGAAACGGATGAGTCCAAGGTGGTGGAGCAT
        CAGGAATATGCCGAAGCGCTGTCAATGTCCGGGGAAAGTCGTAAGCGGAAACGATGGACTCGAAGGTCCTGCTGCACTCG
        CCAAGTCCTGAGTACGGGCGCCATTTTCATCGCCCTTCTGCTCATCATCGGCGCCATTTACATGCACTTAAGACAGAAGC
        ATCATCTGGGCCGACTGCACATCAATCTCAAGGATCGGGGGCAAGTGGAGGTCCTGGAGGAGGACTTTCCCATGGTCACC
        GCTGCGGGAGTGGGTGAGTGTGCCACAAGGACTCTTGTTCAATCGCTAAGAAGCTCTTAGACTTCGGTTAATTTTATAAG
        CGGTTTATATTGTTGGGATAGTGGTATTTTCTCTCTTTTTCTTTGTTTTGTTTTTTTTCTTTCCCAGCTGACTGATTAGA
        ATTGCCATTAGATGAACCAGCAGATTTCAACGTTTCGAAATTATAGCGATAATAAATAAAAGCTTGTATTTATTACACAA
        CAACTATGCAACGCATGCCCAGACCTCGACGATAACAACATTCCAGCCGCCTCCGACATCCTCCCCAGAGCCCAGTGCCA
        AGTGCCTGGACTGCATGGCCACCACTGCCACGGATAATATTCCGGCAATCTGCAGGCACCGAGGACGACCAGAGGAGCCG
        TGCGGCATTTATCGCATCTCCCACGTCTACTGGCAGGACGCACTCCGGATAATTGACCCGGACGACTCACTCGCCCGGGA
        CTACGGAAGATGCGTGGTGGATGTCCAGTGCGCCGAGCGTATTGTGCGTAGCTATGTGCAGCGATATGGTGGCGAGGATT
        GCAATGGAGACGGACGGATCGAGTGTCGGGATCATGTGAGGCTGCACATGAGAGGACCCGGCGGCTGCCGCAGGCAGGAG
        CCACTGGGGAGCCTGTCTGAGAGGAGATTGGAAAACTGCTTGAAATACAGGGGGATTACTTAAAACCG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0076905
        2098
        FBtr0076906
        974
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0076617
        129
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0076614
        263
        FBpp0076615
        116
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Based on cDNA(s) with retained intron; results in premature stop codon and/or downstream start; may or may not produce functional polypeptide.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG14823-RD
        Secondary FlyBase IDs
          References (2)